Incidental Mutation 'R1607:Pdlim3'
ID 176553
Institutional Source Beutler Lab
Gene Symbol Pdlim3
Ensembl Gene ENSMUSG00000031636
Gene Name PDZ and LIM domain 3
Synonyms ALP
MMRRC Submission 039644-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.712) question?
Stock # R1607 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 46338498-46372585 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46349896 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 69 (I69F)
Ref Sequence ENSEMBL: ENSMUSP00000148113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034053] [ENSMUST00000210422]
AlphaFold O70209
Predicted Effect probably damaging
Transcript: ENSMUST00000034053
AA Change: I69F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034053
Gene: ENSMUSG00000031636
AA Change: I69F

DomainStartEndE-ValueType
PDZ 11 84 3.86e-16 SMART
ZM 137 162 5.55e-11 SMART
LIM 245 296 3.73e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210422
AA Change: I69F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211190
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele show no major defects in skeletal muscle. However, homozygotes for another knock-out allele show partial background-sensitive prenatal lethality, embryonic right ventricular (RV) dilation and dysplasia, hypotrabeculation, and RV cardiomyopathy in surviving adults. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 119,850,514 (GRCm39) P789S probably damaging Het
Adam17 T A 12: 21,384,139 (GRCm39) probably null Het
Afdn C T 17: 14,030,763 (GRCm39) R224W probably damaging Het
Als2 A G 1: 59,219,306 (GRCm39) Y1215H probably damaging Het
Anks1b A T 10: 89,878,410 (GRCm39) D73V probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cenpv A T 11: 62,416,002 (GRCm39) M249K probably benign Het
Ces1d C T 8: 93,912,746 (GRCm39) V231I probably benign Het
Clasp1 G A 1: 118,432,689 (GRCm39) V460I probably damaging Het
Cnot10 A T 9: 114,458,163 (GRCm39) Y114* probably null Het
Cpb1 G T 3: 20,317,946 (GRCm39) R193S probably benign Het
Ctc1 T C 11: 68,926,976 (GRCm39) S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,432 (GRCm39) K142M probably damaging Het
Dhrs7b T G 11: 60,742,717 (GRCm39) D136E probably benign Het
Dnah7b T C 1: 46,329,806 (GRCm39) S3217P probably damaging Het
Eif4g3 C T 4: 137,853,874 (GRCm39) S480L probably benign Het
Enah A T 1: 181,744,762 (GRCm39) probably null Het
Epx T C 11: 87,759,538 (GRCm39) D517G probably damaging Het
Gabrg2 T A 11: 41,867,490 (GRCm39) D43V probably damaging Het
Gdf9 A T 11: 53,328,338 (GRCm39) E431D possibly damaging Het
Ghr T C 15: 3,350,056 (GRCm39) D374G probably damaging Het
Gin1 A T 1: 97,713,875 (GRCm39) I392F probably damaging Het
Greb1l A G 18: 10,529,703 (GRCm39) E786G possibly damaging Het
Grk4 T C 5: 34,888,882 (GRCm39) V342A probably benign Het
Hhipl2 A T 1: 183,204,432 (GRCm39) Y135F possibly damaging Het
Insig1 C T 5: 28,276,706 (GRCm39) R91W probably damaging Het
Kcnf1 C G 12: 17,225,733 (GRCm39) D163H probably benign Het
Kif11 A T 19: 37,375,648 (GRCm39) K190* probably null Het
Ldb2 T G 5: 44,630,814 (GRCm39) E309A probably damaging Het
Lipo4 T G 19: 33,490,073 (GRCm39) D143A probably damaging Het
Map3k6 T G 4: 132,979,784 (GRCm39) I1261S probably damaging Het
Mtus1 C T 8: 41,468,446 (GRCm39) V27I possibly damaging Het
Ndufaf2 C T 13: 108,228,107 (GRCm39) V60I probably benign Het
Nup133 A G 8: 124,675,774 (GRCm39) F48L probably benign Het
Or1i2 G T 10: 78,447,974 (GRCm39) T167N probably benign Het
Or2w4 A C 13: 21,795,934 (GRCm39) F68L probably benign Het
Or5w11 T A 2: 87,459,321 (GRCm39) N171K probably benign Het
Pcdhb21 A T 18: 37,648,532 (GRCm39) N554Y probably damaging Het
Pcx A T 19: 4,653,187 (GRCm39) D284V possibly damaging Het
Pcyt1a T C 16: 32,285,937 (GRCm39) S203P probably damaging Het
Pkp4 T C 2: 59,152,898 (GRCm39) V598A probably benign Het
Plbd1 T C 6: 136,589,304 (GRCm39) I509V probably benign Het
Polr3b C A 10: 84,488,647 (GRCm39) T319N probably benign Het
Ptprj T C 2: 90,293,664 (GRCm39) D380G probably benign Het
Ralgapa1 T G 12: 55,788,321 (GRCm39) R587S probably damaging Het
Scn5a C A 9: 119,315,158 (GRCm39) R1850L probably damaging Het
Ssc5d C A 7: 4,947,042 (GRCm39) T1132K probably benign Het
Stard7 T A 2: 127,137,406 (GRCm39) N285K possibly damaging Het
Tcp11l2 C T 10: 84,449,351 (GRCm39) R439W probably damaging Het
Tecrl T C 5: 83,428,355 (GRCm39) probably null Het
Tep1 A T 14: 51,062,020 (GRCm39) L2570Q probably null Het
Tex14 A T 11: 87,445,754 (GRCm39) D191V probably damaging Het
Tm7sf2 A G 19: 6,113,049 (GRCm39) probably null Het
Tmem132e A G 11: 82,328,196 (GRCm39) K408R probably benign Het
Tube1 A G 10: 39,020,762 (GRCm39) D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Vmn2r82 A G 10: 79,215,253 (GRCm39) H412R possibly damaging Het
Wtip T C 7: 33,816,020 (GRCm39) E352G probably damaging Het
Xirp2 T A 2: 67,340,639 (GRCm39) L960* probably null Het
Zc3h11a A C 1: 133,552,425 (GRCm39) S561A probably benign Het
Zfhx2 A T 14: 55,300,442 (GRCm39) D2436E probably damaging Het
Zfp763 T C 17: 33,238,881 (GRCm39) H88R probably benign Het
Other mutations in Pdlim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pdlim3 APN 8 46,349,827 (GRCm39) missense probably damaging 1.00
IGL01341:Pdlim3 APN 8 46,368,277 (GRCm39) missense probably benign
IGL02189:Pdlim3 APN 8 46,338,630 (GRCm39) missense probably damaging 1.00
IGL02834:Pdlim3 APN 8 46,370,569 (GRCm39) missense probably benign 0.02
IGL03165:Pdlim3 APN 8 46,372,035 (GRCm39) missense possibly damaging 0.82
C9142:Pdlim3 UTSW 8 46,349,869 (GRCm39) missense probably benign 0.37
R0244:Pdlim3 UTSW 8 46,361,497 (GRCm39) intron probably benign
R0369:Pdlim3 UTSW 8 46,370,543 (GRCm39) missense probably benign
R1052:Pdlim3 UTSW 8 46,349,837 (GRCm39) missense probably damaging 1.00
R1142:Pdlim3 UTSW 8 46,371,998 (GRCm39) missense probably damaging 1.00
R1531:Pdlim3 UTSW 8 46,349,800 (GRCm39) missense probably damaging 1.00
R1645:Pdlim3 UTSW 8 46,349,785 (GRCm39) missense probably benign 0.37
R5641:Pdlim3 UTSW 8 46,368,300 (GRCm39) splice site probably null
R5731:Pdlim3 UTSW 8 46,368,284 (GRCm39) missense probably benign
R6501:Pdlim3 UTSW 8 46,361,639 (GRCm39) missense possibly damaging 0.95
R7111:Pdlim3 UTSW 8 46,370,539 (GRCm39) missense probably damaging 0.99
R7637:Pdlim3 UTSW 8 46,362,102 (GRCm39) missense probably damaging 1.00
R7701:Pdlim3 UTSW 8 46,361,576 (GRCm39) missense probably benign 0.17
R8223:Pdlim3 UTSW 8 46,353,562 (GRCm39) missense possibly damaging 0.80
R8380:Pdlim3 UTSW 8 46,370,572 (GRCm39) missense probably benign
R9163:Pdlim3 UTSW 8 46,338,711 (GRCm39) critical splice donor site probably null
R9673:Pdlim3 UTSW 8 46,368,195 (GRCm39) missense possibly damaging 0.52
Z1177:Pdlim3 UTSW 8 46,372,021 (GRCm39) nonsense probably null
Z1177:Pdlim3 UTSW 8 46,362,117 (GRCm39) missense possibly damaging 0.77
Z1177:Pdlim3 UTSW 8 46,362,116 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGTTCAAGTCAAGTACCAAAGTTGCCA -3'
(R):5'- GGCAAATACATGAGAAACTCCATCGGA -3'

Sequencing Primer
(F):5'- GTAACACTGAAAACTTTGCCAGG -3'
(R):5'- AGTTCTGGGTCTATGACATTTCTCAC -3'
Posted On 2014-04-24