Incidental Mutation 'R1609:Sf3b2'
ID176699
Institutional Source Beutler Lab
Gene Symbol Sf3b2
Ensembl Gene ENSMUSG00000024853
Gene Namesplicing factor 3b, subunit 2
Synonyms145kDa, 2610311M13Rik, 2810441F20Rik, SF3b150, SF3b145, B230398H18Rik, SAP145, SF3b1
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1609 (G1)
Quality Score182
Status Validated
Chromosome19
Chromosomal Location5273923-5295455 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 5295033 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025774] [ENSMUST00000061169]
Predicted Effect probably benign
Transcript: ENSMUST00000025774
SMART Domains Protein: ENSMUSP00000025774
Gene: ENSMUSG00000024853

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
SAP 24 58 1.84e-4 SMART
low complexity region 91 132 N/A INTRINSIC
coiled coil region 140 178 N/A INTRINSIC
low complexity region 201 221 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 383 397 N/A INTRINSIC
low complexity region 408 437 N/A INTRINSIC
Pfam:DUF382 453 579 2.9e-63 PFAM
PSP 584 642 9.41e-33 SMART
low complexity region 693 717 N/A INTRINSIC
low complexity region 745 756 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061169
SMART Domains Protein: ENSMUSP00000061517
Gene: ENSMUSG00000047658

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 399 3.4e-205 PFAM
Pfam:Sulfotransfer_2 60 298 1.9e-7 PFAM
low complexity region 416 428 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Sf3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Sf3b2 APN 19 5279587 missense probably benign 0.00
IGL01737:Sf3b2 APN 19 5279838 splice site probably benign
IGL02205:Sf3b2 APN 19 5283737 missense probably benign 0.01
R0184:Sf3b2 UTSW 19 5283672 missense probably damaging 1.00
R0370:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0371:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0372:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0373:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R0375:Sf3b2 UTSW 19 5274824 missense probably damaging 1.00
R1606:Sf3b2 UTSW 19 5287998 missense probably benign 0.00
R2566:Sf3b2 UTSW 19 5275090 missense possibly damaging 0.92
R5163:Sf3b2 UTSW 19 5275137 missense probably damaging 1.00
R6208:Sf3b2 UTSW 19 5275098 missense possibly damaging 0.82
R6275:Sf3b2 UTSW 19 5283650 missense probably damaging 1.00
R6644:Sf3b2 UTSW 19 5279964 splice site probably null
R6986:Sf3b2 UTSW 19 5279895 missense probably benign
R7007:Sf3b2 UTSW 19 5274517 missense probably benign 0.13
Z1177:Sf3b2 UTSW 19 5274950 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCTTGCTGCGTTGAAGTACAC -3'
(R):5'- AAGTGGAGCTTGGTTACCCAGGAG -3'

Sequencing Primer
(F):5'- ggaaggcaaacgcattagg -3'
(R):5'- TGGTTACCCAGGAGACCCAC -3'
Posted On2014-04-24