Incidental Mutation 'R1940:Nrg2'
ID213977
Institutional Source Beutler Lab
Gene Symbol Nrg2
Ensembl Gene ENSMUSG00000060275
Gene Nameneuregulin 2
SynonymsNTAK, Don1
MMRRC Submission 039958-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R1940 (G1)
Quality Score142
Status Validated
Chromosome18
Chromosomal Location36017707-36197380 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 36196844 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000115713]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115705
SMART Domains Protein: ENSMUSP00000111370
Gene: ENSMUSG00000060275

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
IGc2 105 175 3.85e-14 SMART
EGF 201 239 3.76e-1 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115712
SMART Domains Protein: ENSMUSP00000111377
Gene: ENSMUSG00000060275

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 1.66e-2 SMART
Pfam:Neuregulin 403 834 1.7e-79 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000115713
AA Change: R106L
SMART Domains Protein: ENSMUSP00000111378
Gene: ENSMUSG00000060275
AA Change: R106L

DomainStartEndE-ValueType
low complexity region 19 66 N/A INTRINSIC
low complexity region 69 111 N/A INTRINSIC
IGc2 259 329 3.85e-14 SMART
EGF 355 393 3.76e-1 SMART
Pfam:Neuregulin 409 844 4.4e-170 PFAM
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel member of the neuregulin family of growth and differentiation factors. Through interaction with the ERBB family of receptors, this protein induces the growth and differentiation of epithelial, neuronal, glial, and other types of cells. The gene consists of 12 exons and the genomic structure is similar to that of neuregulin 1, another member of the neuregulin family of ligands. The products of these genes mediate distinct biological processes by acting at different sites in tissues and eliciting different biological responses in cells. This gene is located close to the region for demyelinating Charcot-Marie-Tooth disease locus, but is not responsible for this disease. Alternative transcript variants encoding distinct isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: About one third of mice homozygous for a knock-out allele die prior to weaning in the absence of cardiac defects or other morphological abnormalities. Homozygotes display an early but transient postnatal growth deficit and reduced reproductive capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,233,852 S2496R probably damaging Het
Abca16 T C 7: 120,433,609 probably benign Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam24 A T 8: 40,681,361 R623* probably null Het
Agbl2 T A 2: 90,811,282 L752Q probably damaging Het
Ankrd26 A T 6: 118,511,693 F1335Y probably damaging Het
Ankrd34a A G 3: 96,598,676 S399G probably benign Het
Ap3d1 G A 10: 80,709,773 P1041S probably benign Het
Arid3b A T 9: 57,796,148 M466K possibly damaging Het
Arsj T C 3: 126,438,346 I247T probably damaging Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Azin2 C T 4: 128,950,784 probably null Het
Bcat2 T C 7: 45,588,368 Y313H possibly damaging Het
Cables2 A G 2: 180,260,080 V465A probably damaging Het
Ccdc60 G A 5: 116,126,165 H517Y probably damaging Het
Cd55b A T 1: 130,418,106 probably null Het
Cdc40 G A 10: 40,883,071 probably benign Het
Cdh7 G A 1: 110,049,024 V140I probably benign Het
Cfi T C 3: 129,858,828 probably benign Het
Chit1 G A 1: 134,145,418 probably null Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clmn G A 12: 104,790,102 T163I probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Col19a1 A T 1: 24,264,750 C1117* probably null Het
Cyp2d10 T A 15: 82,405,294 I206F probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Ddx18 A T 1: 121,555,224 V611D probably damaging Het
Dnah8 A T 17: 30,731,207 H2000L probably damaging Het
Duox1 T C 2: 122,325,984 V464A probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eif4enif1 A G 11: 3,243,279 H857R probably damaging Het
Elmo2 A G 2: 165,292,050 probably benign Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Glrx A G 13: 75,840,137 I57V probably benign Het
Gm281 A T 14: 13,828,582 M726K probably null Het
Golm1 A T 13: 59,642,237 probably benign Het
Grm3 G A 5: 9,511,682 R723W probably damaging Het
Gsta3 G A 1: 21,257,377 R45Q probably benign Het
Gtf3c3 A C 1: 54,428,958 probably benign Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Hs3st3b1 T C 11: 63,889,743 D186G probably benign Het
Hscb G T 5: 110,836,060 H63N probably benign Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Ivl T A 3: 92,572,749 H3L probably benign Het
Klhl26 C A 8: 70,452,261 R252L probably damaging Het
Krt31 T A 11: 100,048,243 T251S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lhx3 T C 2: 26,203,962 D83G probably benign Het
Lss C A 10: 76,545,462 N427K possibly damaging Het
Mettl24 G A 10: 40,737,726 A154T probably benign Het
Mgat4a A T 1: 37,536,037 probably null Het
Moxd2 C T 6: 40,883,532 R326Q probably damaging Het
Mpdz G A 4: 81,361,443 A669V probably benign Het
Msra G A 14: 64,285,056 probably benign Het
Muc13 A T 16: 33,807,911 T344S probably benign Het
Myo3b T C 2: 70,258,075 I866T probably benign Het
Nbea T C 3: 55,953,100 S1852G possibly damaging Het
Ncf2 A G 1: 152,834,064 probably benign Het
Nfyc C A 4: 120,773,664 probably benign Het
Nop2 T C 6: 125,134,634 V110A probably benign Het
Nrl A G 14: 55,522,435 Y12H probably damaging Het
Nrxn3 T C 12: 89,260,381 V635A probably damaging Het
Olfr1014 T A 2: 85,777,171 S196T probably benign Het
Olfr1415 T A 1: 92,491,735 T7S probably benign Het
Olfr1423 A C 19: 12,035,911 V277G probably benign Het
Olfr228 T A 2: 86,483,359 K128* probably null Het
Papolg A T 11: 23,867,279 N639K probably benign Het
Paqr4 T C 17: 23,737,664 I242V probably damaging Het
Pramel6 A T 2: 87,508,732 K92M probably damaging Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprb A T 10: 116,319,610 probably benign Het
Rab28 A T 5: 41,625,790 S216T probably benign Het
Rrp1b A T 17: 32,056,845 R455S possibly damaging Het
Sash1 A T 10: 8,729,932 M898K probably benign Het
Scn8a C T 15: 100,970,204 T310I probably benign Het
Secisbp2l C A 2: 125,740,339 D1066Y probably damaging Het
Sipa1l2 A G 8: 125,480,148 probably benign Het
Slc12a1 A G 2: 125,194,193 T662A probably benign Het
Slc12a4 T C 8: 105,946,037 I749V probably benign Het
Slc22a27 A G 19: 7,909,727 S266P probably damaging Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slit1 T A 19: 41,630,776 N762I probably damaging Het
Spata31d1b C A 13: 59,718,021 D994E possibly damaging Het
Sphk1 A G 11: 116,535,850 I204V probably benign Het
Srsf6 C T 2: 162,934,483 probably benign Het
Svs1 A T 6: 48,990,073 K652* probably null Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tgfbi A T 13: 56,614,314 Q70L possibly damaging Het
Tlr9 T C 9: 106,224,647 L379P probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Tra2b A G 16: 22,255,045 probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trnau1ap A G 4: 132,321,803 Y30H probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ush2a A G 1: 188,951,561 D4979G probably null Het
Usp50 C T 2: 126,778,023 R123Q probably benign Het
Vmn2r117 A T 17: 23,477,480 Y318N probably damaging Het
Whamm C T 7: 81,578,299 T304I probably null Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Ythdf3 A G 3: 16,205,092 N468D possibly damaging Het
Zbtb17 T C 4: 141,465,548 I486T possibly damaging Het
Zfp3 T C 11: 70,771,376 S54P probably benign Het
Zscan10 A T 17: 23,609,852 H379L probably damaging Het
Other mutations in Nrg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nrg2 APN 18 36021218 missense probably benign 0.00
IGL01396:Nrg2 APN 18 36045852 splice site probably benign
R0179:Nrg2 UTSW 18 36022415 missense probably benign 0.13
R0976:Nrg2 UTSW 18 36021091 missense probably benign 0.21
R1387:Nrg2 UTSW 18 36196739 missense probably damaging 1.00
R1487:Nrg2 UTSW 18 36052912 missense possibly damaging 0.69
R1746:Nrg2 UTSW 18 36021922 missense probably damaging 1.00
R1882:Nrg2 UTSW 18 36021097 missense probably damaging 1.00
R2090:Nrg2 UTSW 18 36018443 missense probably benign 0.00
R2183:Nrg2 UTSW 18 36196751 missense probably benign 0.11
R4664:Nrg2 UTSW 18 36052895 missense possibly damaging 0.87
R4677:Nrg2 UTSW 18 36021099 missense possibly damaging 0.92
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R4860:Nrg2 UTSW 18 36196547 missense probably damaging 1.00
R5091:Nrg2 UTSW 18 36052785 missense probably damaging 1.00
R6657:Nrg2 UTSW 18 36196589 missense probably damaging 0.98
R6968:Nrg2 UTSW 18 36196446 missense probably benign 0.01
R7186:Nrg2 UTSW 18 36045920 missense probably benign 0.17
R7304:Nrg2 UTSW 18 36045941 missense probably benign 0.24
R7467:Nrg2 UTSW 18 36022406 missense probably benign 0.00
R7564:Nrg2 UTSW 18 36024396 missense probably damaging 1.00
R7876:Nrg2 UTSW 18 36197087 missense unknown
R8113:Nrg2 UTSW 18 36021103 missense probably damaging 1.00
R8133:Nrg2 UTSW 18 36032377 missense probably benign 0.00
R8214:Nrg2 UTSW 18 36196676 missense probably benign 0.02
R8261:Nrg2 UTSW 18 36032375 missense probably benign 0.11
Z1176:Nrg2 UTSW 18 36018470 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTCCAGCACCTTCACCAG -3'
(R):5'- CAGCTACAGTTACAGCGACAG -3'

Sequencing Primer
(F):5'- TTCACCAGCGCCACCCG -3'
(R):5'- CCAGCAGCAGCAGAAGCAG -3'
Posted On2014-07-14