Incidental Mutation 'R1940:Ddx18'
ID213874
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
MMRRC Submission 039958-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1940 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121555224 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 611 (V611D)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably damaging
Transcript: ENSMUST00000001724
AA Change: V611D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: V611D

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134417
SMART Domains Protein: ENSMUSP00000114149
Gene: ENSMUSG00000001674

DomainStartEndE-ValueType
Blast:DEXDc 2 47 2e-22 BLAST
HELICc 65 146 2.84e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148809
Meta Mutation Damage Score 0.9182 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,233,852 S2496R probably damaging Het
Abca16 T C 7: 120,433,609 probably benign Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam24 A T 8: 40,681,361 R623* probably null Het
Agbl2 T A 2: 90,811,282 L752Q probably damaging Het
Ankrd26 A T 6: 118,511,693 F1335Y probably damaging Het
Ankrd34a A G 3: 96,598,676 S399G probably benign Het
Ap3d1 G A 10: 80,709,773 P1041S probably benign Het
Arid3b A T 9: 57,796,148 M466K possibly damaging Het
Arsj T C 3: 126,438,346 I247T probably damaging Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Azin2 C T 4: 128,950,784 probably null Het
Bcat2 T C 7: 45,588,368 Y313H possibly damaging Het
Cables2 A G 2: 180,260,080 V465A probably damaging Het
Ccdc60 G A 5: 116,126,165 H517Y probably damaging Het
Cd55b A T 1: 130,418,106 probably null Het
Cdc40 G A 10: 40,883,071 probably benign Het
Cdh7 G A 1: 110,049,024 V140I probably benign Het
Cfi T C 3: 129,858,828 probably benign Het
Chit1 G A 1: 134,145,418 probably null Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clmn G A 12: 104,790,102 T163I probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Col19a1 A T 1: 24,264,750 C1117* probably null Het
Cyp2d10 T A 15: 82,405,294 I206F probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Dnah8 A T 17: 30,731,207 H2000L probably damaging Het
Duox1 T C 2: 122,325,984 V464A probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eif4enif1 A G 11: 3,243,279 H857R probably damaging Het
Elmo2 A G 2: 165,292,050 probably benign Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Glrx A G 13: 75,840,137 I57V probably benign Het
Gm281 A T 14: 13,828,582 M726K probably null Het
Golm1 A T 13: 59,642,237 probably benign Het
Grm3 G A 5: 9,511,682 R723W probably damaging Het
Gsta3 G A 1: 21,257,377 R45Q probably benign Het
Gtf3c3 A C 1: 54,428,958 probably benign Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Hs3st3b1 T C 11: 63,889,743 D186G probably benign Het
Hscb G T 5: 110,836,060 H63N probably benign Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Ivl T A 3: 92,572,749 H3L probably benign Het
Klhl26 C A 8: 70,452,261 R252L probably damaging Het
Krt31 T A 11: 100,048,243 T251S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lhx3 T C 2: 26,203,962 D83G probably benign Het
Lss C A 10: 76,545,462 N427K possibly damaging Het
Mettl24 G A 10: 40,737,726 A154T probably benign Het
Mgat4a A T 1: 37,536,037 probably null Het
Moxd2 C T 6: 40,883,532 R326Q probably damaging Het
Mpdz G A 4: 81,361,443 A669V probably benign Het
Msra G A 14: 64,285,056 probably benign Het
Muc13 A T 16: 33,807,911 T344S probably benign Het
Myo3b T C 2: 70,258,075 I866T probably benign Het
Nbea T C 3: 55,953,100 S1852G possibly damaging Het
Ncf2 A G 1: 152,834,064 probably benign Het
Nfyc C A 4: 120,773,664 probably benign Het
Nop2 T C 6: 125,134,634 V110A probably benign Het
Nrg2 C A 18: 36,196,844 probably benign Het
Nrl A G 14: 55,522,435 Y12H probably damaging Het
Nrxn3 T C 12: 89,260,381 V635A probably damaging Het
Olfr1014 T A 2: 85,777,171 S196T probably benign Het
Olfr1415 T A 1: 92,491,735 T7S probably benign Het
Olfr1423 A C 19: 12,035,911 V277G probably benign Het
Olfr228 T A 2: 86,483,359 K128* probably null Het
Papolg A T 11: 23,867,279 N639K probably benign Het
Paqr4 T C 17: 23,737,664 I242V probably damaging Het
Pramel6 A T 2: 87,508,732 K92M probably damaging Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprb A T 10: 116,319,610 probably benign Het
Rab28 A T 5: 41,625,790 S216T probably benign Het
Rrp1b A T 17: 32,056,845 R455S possibly damaging Het
Sash1 A T 10: 8,729,932 M898K probably benign Het
Scn8a C T 15: 100,970,204 T310I probably benign Het
Secisbp2l C A 2: 125,740,339 D1066Y probably damaging Het
Sipa1l2 A G 8: 125,480,148 probably benign Het
Slc12a1 A G 2: 125,194,193 T662A probably benign Het
Slc12a4 T C 8: 105,946,037 I749V probably benign Het
Slc22a27 A G 19: 7,909,727 S266P probably damaging Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slit1 T A 19: 41,630,776 N762I probably damaging Het
Spata31d1b C A 13: 59,718,021 D994E possibly damaging Het
Sphk1 A G 11: 116,535,850 I204V probably benign Het
Srsf6 C T 2: 162,934,483 probably benign Het
Svs1 A T 6: 48,990,073 K652* probably null Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tgfbi A T 13: 56,614,314 Q70L possibly damaging Het
Tlr9 T C 9: 106,224,647 L379P probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Tra2b A G 16: 22,255,045 probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trnau1ap A G 4: 132,321,803 Y30H probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ush2a A G 1: 188,951,561 D4979G probably null Het
Usp50 C T 2: 126,778,023 R123Q probably benign Het
Vmn2r117 A T 17: 23,477,480 Y318N probably damaging Het
Whamm C T 7: 81,578,299 T304I probably null Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Ythdf3 A G 3: 16,205,092 N468D possibly damaging Het
Zbtb17 T C 4: 141,465,548 I486T possibly damaging Het
Zfp3 T C 11: 70,771,376 S54P probably benign Het
Zscan10 A T 17: 23,609,852 H379L probably damaging Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R7949:Ddx18 UTSW 1 121555318 missense probably damaging 1.00
R8291:Ddx18 UTSW 1 121560175 missense probably damaging 0.99
R8318:Ddx18 UTSW 1 121566087 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGTCCTGAGCTGCCTTCTTG -3'
(R):5'- AACTGTTCTAATAGTTGACGTCTGC -3'

Sequencing Primer
(F):5'- GGTAATTCCCACCCCAGTG -3'
(R):5'- TGCCCAGGAAGCATACA -3'
Posted On2014-07-14