Incidental Mutation 'R1945:Krt33a'
ID216605
Institutional Source Beutler Lab
Gene Symbol Krt33a
Ensembl Gene ENSMUSG00000035592
Gene Namekeratin 33A
Synonyms2310015J09Rik
MMRRC Submission 039963-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1945 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100011195-100016212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100012709 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 199 (N199S)
Ref Sequence ENSEMBL: ENSMUSP00000018399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018399]
Predicted Effect probably benign
Transcript: ENSMUST00000018399
AA Change: N199S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018399
Gene: ENSMUSG00000035592
AA Change: N199S

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 1.99e-148 SMART
internal_repeat_1 368 385 6.11e-5 PROSPERO
internal_repeat_1 384 399 6.11e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138756
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations of this gene cause the hair coat to appear either shiny, reflective and "polished" or greasy looking, disheveled and "spikey." [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T A 14: 49,768,483 E585V probably damaging Het
4930562C15Rik A G 16: 4,835,685 I33V unknown Het
4931408C20Rik C A 1: 26,682,314 V1262F probably benign Het
Abca1 ACGTCTTCACCAGGTAATC AC 4: 53,061,509 probably null Het
Amotl2 T C 9: 102,720,554 S171P probably benign Het
Atf6 A T 1: 170,855,141 V34E probably benign Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bglap A G 3: 88,383,664 Y87H probably damaging Het
Camk2n1 G A 4: 138,456,783 V78I possibly damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Cdc14b T C 13: 64,219,890 Y208C probably damaging Het
Cdc42bpb C T 12: 111,299,133 R1455Q probably damaging Het
Cep170 C A 1: 176,793,534 G26* probably null Het
Cfap46 A G 7: 139,679,903 F217S probably damaging Het
Col11a2 A T 17: 34,059,168 D691V probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Coq8b CGCA CGCAGCA 7: 27,233,980 probably benign Het
Coq8b GCA GCAACA 7: 27,233,981 probably benign Het
Dcaf5 T C 12: 80,338,694 D886G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
Etaa1 A G 11: 17,947,233 C295R probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Ghdc C T 11: 100,769,205 A239T probably benign Het
Gm906 C T 13: 50,245,491 G933E probably damaging Het
Grik4 T C 9: 42,521,004 D899G possibly damaging Het
Hacd2 C A 16: 35,101,984 T181K possibly damaging Het
Havcr2 T C 11: 46,455,050 L17P unknown Het
Herc3 T C 6: 58,887,439 V686A probably damaging Het
Hyal3 T C 9: 107,585,472 L235P probably damaging Het
Itgb4 C T 11: 115,993,453 Q988* probably null Het
Krt32 T A 11: 100,084,844 probably null Het
Lama1 T A 17: 67,745,853 S394T probably benign Het
Lamp1 T C 8: 13,172,545 V243A probably benign Het
Loxhd1 A G 18: 77,404,808 Y1315C probably damaging Het
Macf1 A T 4: 123,490,660 L1148* probably null Het
Mill2 A G 7: 18,841,494 H42R probably benign Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Myo15b A T 11: 115,878,398 I1472F probably damaging Het
Nasp T C 4: 116,622,768 S36G possibly damaging Het
Nav2 A G 7: 49,464,872 Y868C probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Npc1l1 C T 11: 6,225,199 W592* probably null Het
Nsg2 T C 11: 32,055,068 V90A probably damaging Het
Odf4 T C 11: 68,922,157 N225S possibly damaging Het
Olfr1230 T C 2: 89,296,784 Y162C probably damaging Het
Olfr340 T C 2: 36,453,031 W149R probably damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pcdhb4 A T 18: 37,308,868 R410S probably damaging Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pik3ap1 A T 19: 41,274,337 S799T probably benign Het
Pitx2 A G 3: 129,218,536 N198S probably damaging Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Recql5 G A 11: 115,928,297 R148* probably null Het
Reep3 A G 10: 67,035,899 S97P probably damaging Het
Rnase12 T A 14: 51,057,006 Q72L possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Scn10a A T 9: 119,691,454 S127T possibly damaging Het
Scn7a A T 2: 66,675,980 W1522R probably damaging Het
Senp7 A G 16: 56,123,946 H211R probably damaging Het
Sept10 C T 10: 59,181,019 probably null Het
Serpinb6d T C 13: 33,667,680 V140A possibly damaging Het
Sned1 A G 1: 93,271,238 E457G probably benign Het
Spag17 A C 3: 99,939,982 M76L probably benign Het
Ssfa2 T C 2: 79,662,652 V1181A probably benign Het
Sspo A T 6: 48,489,773 E105V possibly damaging Het
Stoml3 T A 3: 53,505,445 D173E possibly damaging Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Svil T C 18: 5,117,059 W2165R probably damaging Het
Tbl2 T A 5: 135,157,600 S184T possibly damaging Het
Tdrd7 A T 4: 45,965,474 T31S probably benign Het
Tmeff1 A G 4: 48,614,960 N139S possibly damaging Het
Trip13 T C 13: 73,927,924 R199G probably damaging Het
Tshb G T 3: 102,777,515 Y124* probably null Het
Ttn T C 2: 76,730,022 E29345G probably damaging Het
Usp33 T A 3: 152,379,586 S620T probably benign Het
Vipr1 G A 9: 121,668,474 G353R probably damaging Het
Vipr1 G T 9: 121,668,475 G353V probably damaging Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Ylpm1 T A 12: 85,015,418 S240T probably damaging Het
Zfp772 A G 7: 7,203,630 I354T probably benign Het
Zfp959 T A 17: 55,897,231 Y86* probably null Het
Other mutations in Krt33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Krt33a APN 11 100012017 missense probably benign 0.35
IGL02412:Krt33a APN 11 100011979 missense probably benign 0.01
IGL02523:Krt33a APN 11 100011692 missense probably benign 0.02
Polished UTSW 11 100012611 missense probably damaging 1.00
Polished2 UTSW 11 100015850 missense probably benign 0.10
Spikey UTSW 11 100011939 missense probably damaging 1.00
R0492:Krt33a UTSW 11 100016083 missense probably benign 0.02
R0496:Krt33a UTSW 11 100012329 splice site probably benign
R0691:Krt33a UTSW 11 100012715 missense probably damaging 1.00
R1077:Krt33a UTSW 11 100015937 missense probably benign
R1624:Krt33a UTSW 11 100014246 missense probably damaging 1.00
R1911:Krt33a UTSW 11 100012349 missense probably benign 0.35
R1944:Krt33a UTSW 11 100012709 missense probably benign 0.10
R2254:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R2255:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R3716:Krt33a UTSW 11 100014165 missense probably benign 0.01
R4377:Krt33a UTSW 11 100012427 missense possibly damaging 0.46
R5233:Krt33a UTSW 11 100014135 missense probably damaging 1.00
R6029:Krt33a UTSW 11 100012463 missense probably benign 0.01
R6316:Krt33a UTSW 11 100014201 missense probably damaging 0.98
R6807:Krt33a UTSW 11 100012383 missense possibly damaging 0.61
R7272:Krt33a UTSW 11 100012011 missense probably damaging 1.00
R7323:Krt33a UTSW 11 100011975 missense probably benign 0.08
R7461:Krt33a UTSW 11 100011939 missense probably damaging 1.00
R7613:Krt33a UTSW 11 100011939 missense probably damaging 1.00
R7657:Krt33a UTSW 11 100015867 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCAGACCCTGCCTTACAGTC -3'
(R):5'- GCTTGAAGGTGCTTTGAGAAAG -3'

Sequencing Primer
(F):5'- CCTGAGTTACCATGGGCTCAGATG -3'
(R):5'- CTTGAAGGTGCTTTGAGAAAGGAATC -3'
Posted On2014-08-01