Mutagenetix > Incidental Mutations

Incidental Mutation 'R1945:Svil'

216628

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

039963-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R1945 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5117059 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 2165 (W2165R)

Ref Sequence

ENSEMBL: ENSMUSP00000147843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025079
AA Change: W2078R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: W2078R

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125512

SMART Domains

Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	168	178	N/A	INTRINSIC
GEL	384	483	4.58e-22	SMART
GEL	508	625	4.03e-1	SMART
Blast:GEL	695	733	1e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000126977
AA Change: W2078R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: W2078R

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127297
AA Change: W1964R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: W1964R

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129543

Predicted Effect

probably benign
Transcript: ENSMUST00000131609

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140448
AA Change: W2078R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: W2078R

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143254
AA Change: W1674R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: W1674R

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146723

SMART Domains

Protein: ENSMUSP00000115591
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
Blast:GEL	2	37	1e-17	BLAST
SCOP:d1d0na6	53	168	3e-19	SMART
Blast:GEL	63	169	1e-72	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000210707
AA Change: W2165R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	A	14: 49,768,483	E585V	probably damaging	Het
4930562C15Rik	A	G	16: 4,835,685	I33V	unknown	Het
4931408C20Rik	C	A	1: 26,682,314	V1262F	probably benign	Het
Abca1	ACGTCTTCACCAGGTAATC	AC	4: 53,061,509		probably null	Het
Amotl2	T	C	9: 102,720,554	S171P	probably benign	Het
Atf6	A	T	1: 170,855,141	V34E	probably benign	Het
Atrip	T	A	9: 109,071,867	I135F	probably damaging	Het
Bglap	A	G	3: 88,383,664	Y87H	probably damaging	Het
Camk2n1	G	A	4: 138,456,783	V78I	possibly damaging	Het
Ccdc92b	A	G	11: 74,630,009	I46V	probably benign	Het
Cdc14b	T	C	13: 64,219,890	Y208C	probably damaging	Het
Cdc42bpb	C	T	12: 111,299,133	R1455Q	probably damaging	Het
Cep170	C	A	1: 176,793,534	G26*	probably null	Het
Cfap46	A	G	7: 139,679,903	F217S	probably damaging	Het
Col11a2	A	T	17: 34,059,168	D691V	probably damaging	Het
Col7a1	G	A	9: 108,960,010	V798I	unknown	Het
Coq8b	CGCA	CGCAGCA	7: 27,233,980		probably benign	Het
Coq8b	GCA	GCAACA	7: 27,233,981		probably benign	Het
Dcaf5	T	C	12: 80,338,694	D886G	probably benign	Het
Ern1	A	G	11: 106,421,950	S202P	probably damaging	Het
Etaa1	A	G	11: 17,947,233	C295R	probably damaging	Het
Fam129a	T	C	1: 151,696,228	I308T	probably damaging	Het
Ghdc	C	T	11: 100,769,205	A239T	probably benign	Het
Gm906	C	T	13: 50,245,491	G933E	probably damaging	Het
Grik4	T	C	9: 42,521,004	D899G	possibly damaging	Het
Hacd2	C	A	16: 35,101,984	T181K	possibly damaging	Het
Havcr2	T	C	11: 46,455,050	L17P	unknown	Het
Herc3	T	C	6: 58,887,439	V686A	probably damaging	Het
Hyal3	T	C	9: 107,585,472	L235P	probably damaging	Het
Itgb4	C	T	11: 115,993,453	Q988*	probably null	Het
Krt32	T	A	11: 100,084,844		probably null	Het
Krt33a	T	C	11: 100,012,709	N199S	probably benign	Het
Lama1	T	A	17: 67,745,853	S394T	probably benign	Het
Lamp1	T	C	8: 13,172,545	V243A	probably benign	Het
Loxhd1	A	G	18: 77,404,808	Y1315C	probably damaging	Het
Macf1	A	T	4: 123,490,660	L1148*	probably null	Het
Mill2	A	G	7: 18,841,494	H42R	probably benign	Het
Myo15	T	C	11: 60,502,083	F2194L	probably damaging	Het
Myo15b	A	T	11: 115,878,398	I1472F	probably damaging	Het
Nasp	T	C	4: 116,622,768	S36G	possibly damaging	Het
Nav2	A	G	7: 49,464,872	Y868C	probably damaging	Het
Nono	T	C	X: 101,441,823		probably null	Het
Npc1l1	T	A	11: 6,214,588	I1154F	possibly damaging	Het
Npc1l1	C	T	11: 6,225,199	W592*	probably null	Het
Nsg2	T	C	11: 32,055,068	V90A	probably damaging	Het
Odf4	T	C	11: 68,922,157	N225S	possibly damaging	Het
Olfr1230	T	C	2: 89,296,784	Y162C	probably damaging	Het
Olfr340	T	C	2: 36,453,031	W149R	probably damaging	Het
Oosp2	C	T	19: 11,649,595		probably null	Het
Pcdhb4	A	T	18: 37,308,868	R410S	probably damaging	Het
Pde6c	T	A	19: 38,157,519	D418E	probably damaging	Het
Pik3ap1	A	T	19: 41,274,337	S799T	probably benign	Het
Pitx2	A	G	3: 129,218,536	N198S	probably damaging	Het
Psmb3	T	C	11: 97,711,155	F117S	probably benign	Het
Ptprq	A	T	10: 107,582,388	M1709K	probably benign	Het
Recql5	G	A	11: 115,928,297	R148*	probably null	Het
Reep3	A	G	10: 67,035,899	S97P	probably damaging	Het
Rnase12	T	A	14: 51,057,006	Q72L	possibly damaging	Het
Scd3	T	C	19: 44,235,780	Y151H	probably benign	Het
Scn10a	A	T	9: 119,691,454	S127T	possibly damaging	Het
Scn7a	A	T	2: 66,675,980	W1522R	probably damaging	Het
Senp7	A	G	16: 56,123,946	H211R	probably damaging	Het
Sept10	C	T	10: 59,181,019		probably null	Het
Serpinb6d	T	C	13: 33,667,680	V140A	possibly damaging	Het
Sned1	A	G	1: 93,271,238	E457G	probably benign	Het
Spag17	A	C	3: 99,939,982	M76L	probably benign	Het
Ssfa2	T	C	2: 79,662,652	V1181A	probably benign	Het
Sspo	A	T	6: 48,489,773	E105V	possibly damaging	Het
Stoml3	T	A	3: 53,505,445	D173E	possibly damaging	Het
Sun3	T	C	11: 9,038,296	I9V	probably benign	Het
Tbl2	T	A	5: 135,157,600	S184T	possibly damaging	Het
Tdrd7	A	T	4: 45,965,474	T31S	probably benign	Het
Tmeff1	A	G	4: 48,614,960	N139S	possibly damaging	Het
Trip13	T	C	13: 73,927,924	R199G	probably damaging	Het
Tshb	G	T	3: 102,777,515	Y124*	probably null	Het
Ttn	T	C	2: 76,730,022	E29345G	probably damaging	Het
Usp33	T	A	3: 152,379,586	S620T	probably benign	Het
Vipr1	G	A	9: 121,668,474	G353R	probably damaging	Het
Vipr1	G	T	9: 121,668,475	G353V	probably damaging	Het
Vps13c	A	T	9: 67,886,276	D437V	probably damaging	Het
Ylpm1	T	A	12: 85,015,418	S240T	probably damaging	Het
Zfp772	A	G	7: 7,203,630	I354T	probably benign	Het
Zfp959	T	A	17: 55,897,231	Y86*	probably null	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0281:Svil	UTSW	18	5094582	missense	probably damaging	1.00
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0617:Svil	UTSW	18	5117002	missense	probably damaging	1.00
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4921:Svil	UTSW	18	5108631	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5061:Svil	UTSW	18	5048954	missense	probably benign	0.02
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	unclassified	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6114:Svil	UTSW	18	5108639	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R6916:Svil	UTSW	18	5114682	utr 3 prime	probably benign
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCACCTGTGTGTTGCTTTAAG -3'
(R):5'- GCTTGCTCACCATCATGCAC -3'

Sequencing Primer
(F):5'- GATCCGAGTTCTAAACATGGAAGTC -3'
(R):5'- GCTCACCATCATGCACTGTTC -3'

Posted On

2014-08-01