Incidental Mutation 'R2022:Tm9sf3'
ID224249
Institutional Source Beutler Lab
Gene Symbol Tm9sf3
Ensembl Gene ENSMUSG00000025016
Gene Nametransmembrane 9 superfamily member 3
Synonyms1810073M23Rik, 2810031D16Rik, Smbp
MMRRC Submission 040031-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2022 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41210842-41264004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41238792 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 280 (F280S)
Ref Sequence ENSEMBL: ENSMUSP00000025989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025989]
Predicted Effect probably damaging
Transcript: ENSMUST00000025989
AA Change: F280S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025989
Gene: ENSMUSG00000025016
AA Change: F280S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:EMP70 55 544 6.2e-164 PFAM
transmembrane domain 549 571 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1cl T A 1: 65,014,698 Y271F probably benign Het
Asnsd1 A G 1: 53,347,227 S414P possibly damaging Het
Atp12a T A 14: 56,365,282 M1K probably null Het
Atp4b A C 8: 13,387,477 N225K possibly damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cactin C T 10: 81,322,893 T231I possibly damaging Het
Casp8ap2 T C 4: 32,644,560 V1211A probably benign Het
Ccdc180 C A 4: 45,944,418 H1423N probably benign Het
Chd9 T C 8: 91,035,054 Y2256H probably benign Het
Chst8 A G 7: 34,675,164 Y417H possibly damaging Het
Clcn6 A G 4: 148,010,652 probably null Het
Clec5a A T 6: 40,585,194 V12E probably damaging Het
Crebbp C T 16: 4,085,819 R1852H probably damaging Het
Cyp2c40 T A 19: 39,812,780 probably benign Het
Dip2c T C 13: 9,551,800 L265P probably damaging Het
Dnah3 A G 7: 119,951,242 Y3274H probably damaging Het
Dnah6 T A 6: 73,027,422 T3853S probably benign Het
Dnttip2 T C 3: 122,276,221 S362P probably damaging Het
Dst G A 1: 34,166,291 V1025I possibly damaging Het
Dym T C 18: 75,080,250 V181A probably benign Het
Elk3 T A 10: 93,265,677 I71F probably damaging Het
Epb41l4a C T 18: 33,921,840 S65N probably benign Het
Erap1 T A 13: 74,666,508 V451E probably benign Het
F830045P16Rik T A 2: 129,472,665 I231F probably damaging Het
Fahd1 T C 17: 24,849,840 I88V probably benign Het
Fam120b C T 17: 15,424,376 T744I possibly damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Frem1 G T 4: 82,913,558 T1988K probably benign Het
Gdap1l1 A T 2: 163,447,597 T161S probably benign Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gm597 A T 1: 28,778,153 V266D probably damaging Het
Gm6309 C T 5: 146,168,311 G264D probably benign Het
Gm9268 A G 7: 43,024,030 N171D probably benign Het
Hsd11b1 T C 1: 193,240,378 T124A probably benign Het
Ino80b A G 6: 83,124,372 M119T probably damaging Het
Kif3a G A 11: 53,570,581 V17M probably damaging Het
Krt40 T A 11: 99,539,992 E285D probably damaging Het
Lair1 C G 7: 4,063,064 probably null Het
Lvrn A G 18: 46,866,436 T290A possibly damaging Het
Macf1 G T 4: 123,472,730 A2746E probably damaging Het
Matn4 A G 2: 164,400,653 V175A probably damaging Het
Mok A T 12: 110,811,823 D216E probably benign Het
Muc15 A T 2: 110,731,476 T86S probably benign Het
Myo16 A G 8: 10,272,633 K21R probably benign Het
Ncl A G 1: 86,356,955 probably null Het
Nfrkb C T 9: 31,411,250 T872I probably benign Het
Nhlrc2 A T 19: 56,597,278 E648D probably benign Het
Nlrp9c A T 7: 26,384,796 Y453N probably damaging Het
Notch4 T C 17: 34,587,528 L1813P probably damaging Het
Nrg3 T A 14: 38,376,352 D515V probably damaging Het
Nsd1 T C 13: 55,213,279 V20A probably damaging Het
Olfr825 T C 10: 130,163,180 M49V probably benign Het
Opn4 T A 14: 34,597,071 T186S probably benign Het
Pcdh15 T G 10: 74,631,193 S1684A possibly damaging Het
Phf11a T A 14: 59,294,914 E24V possibly damaging Het
Pigg A T 5: 108,312,922 probably benign Het
Plscr2 A G 9: 92,295,594 D136G probably damaging Het
Ppp3r2 T C 4: 49,681,723 I76V probably benign Het
Prdm6 A G 18: 53,464,959 probably benign Het
Prex1 A G 2: 166,575,614 W1188R possibly damaging Het
Prmt2 T A 10: 76,225,458 R65* probably null Het
Prom1 G T 5: 44,029,726 D396E probably benign Het
Ptcd3 C T 6: 71,885,553 C466Y probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Rab36 T C 10: 75,052,474 I250T probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Serpinb3d A G 1: 107,078,452 V302A probably benign Het
Slc22a16 T C 10: 40,591,877 Y469H probably damaging Het
Smo A G 6: 29,754,716 N262D possibly damaging Het
Sptan1 C T 2: 30,007,561 A1212V probably damaging Het
Ssr1 C T 13: 37,989,549 A79T probably damaging Het
Tctex1d4 A G 4: 117,128,307 E109G possibly damaging Het
Tiam1 T A 16: 89,877,187 T479S probably benign Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Tnr A G 1: 159,852,022 I189V probably benign Het
Tpbpa T A 13: 60,940,222 N50I probably benign Het
Tshz1 T A 18: 84,013,862 Y807F probably damaging Het
Tspo2 C T 17: 48,448,722 A131T possibly damaging Het
Usp16 T C 16: 87,473,126 L322P probably damaging Het
Vmn1r185 A G 7: 26,611,510 V190A possibly damaging Het
Vmn1r34 T C 6: 66,637,401 K118E possibly damaging Het
Vmn1r68 A G 7: 10,527,991 L60P probably damaging Het
Vps51 T C 19: 6,071,582 E162G probably benign Het
Wdr66 G A 5: 123,273,790 G495D probably benign Het
Yy1 CGGG CGGGGGG 12: 108,793,990 probably benign Het
Zdhhc4 C T 5: 143,321,783 R161H probably damaging Het
Zfp456 A T 13: 67,366,497 C363* probably null Het
Zfp541 T A 7: 16,082,185 S866T probably damaging Het
Other mutations in Tm9sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Tm9sf3 APN 19 41256276 missense probably damaging 1.00
IGL02176:Tm9sf3 APN 19 41246637 splice site probably benign
PIT4687001:Tm9sf3 UTSW 19 41218191 missense probably damaging 1.00
R0504:Tm9sf3 UTSW 19 41247892 splice site probably benign
R0564:Tm9sf3 UTSW 19 41245525 splice site probably benign
R0586:Tm9sf3 UTSW 19 41256143 critical splice donor site probably null
R1224:Tm9sf3 UTSW 19 41223195 missense probably damaging 1.00
R1533:Tm9sf3 UTSW 19 41238784 missense probably benign 0.00
R1646:Tm9sf3 UTSW 19 41223179 missense possibly damaging 0.79
R1748:Tm9sf3 UTSW 19 41256229 missense probably benign 0.01
R2172:Tm9sf3 UTSW 19 41217420 missense probably damaging 1.00
R3844:Tm9sf3 UTSW 19 41217116 missense possibly damaging 0.95
R3878:Tm9sf3 UTSW 19 41246713 missense probably damaging 0.98
R4384:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4385:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4582:Tm9sf3 UTSW 19 41256166 missense probably damaging 1.00
R5497:Tm9sf3 UTSW 19 41215116 missense probably benign 0.03
R5876:Tm9sf3 UTSW 19 41240584 missense probably damaging 1.00
R6305:Tm9sf3 UTSW 19 41245442 critical splice donor site probably null
R6924:Tm9sf3 UTSW 19 41218278 missense probably damaging 1.00
R6936:Tm9sf3 UTSW 19 41223199 missense probably benign 0.44
R7121:Tm9sf3 UTSW 19 41245505 nonsense probably null
R7287:Tm9sf3 UTSW 19 41217379 missense probably damaging 1.00
R7303:Tm9sf3 UTSW 19 41238759 missense probably damaging 0.97
R7677:Tm9sf3 UTSW 19 41221304 missense probably damaging 1.00
R8212:Tm9sf3 UTSW 19 41240635 missense probably damaging 0.99
R8220:Tm9sf3 UTSW 19 41215087 missense possibly damaging 0.80
X0026:Tm9sf3 UTSW 19 41246762 missense possibly damaging 0.91
X0026:Tm9sf3 UTSW 19 41246763 nonsense probably null
Z1088:Tm9sf3 UTSW 19 41232378 missense probably damaging 1.00
Z1176:Tm9sf3 UTSW 19 41238809 missense probably damaging 1.00
Z1177:Tm9sf3 UTSW 19 41245445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTGATGTCCAGCCATG -3'
(R):5'- GTCTGTCCTCAGTATTTTGAACTG -3'

Sequencing Primer
(F):5'- GATCTTTCTGCAATAATAGCACAGG -3'
(R):5'- GGGCTGATTTTGTCTACAC -3'
Posted On2014-08-25