Incidental Mutation 'R4384:Tm9sf3'
ID326139
Institutional Source Beutler Lab
Gene Symbol Tm9sf3
Ensembl Gene ENSMUSG00000025016
Gene Nametransmembrane 9 superfamily member 3
Synonyms1810073M23Rik, 2810031D16Rik, Smbp
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41210842-41264004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41247933 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 130 (M130V)
Ref Sequence ENSEMBL: ENSMUSP00000025989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025989]
Predicted Effect probably damaging
Transcript: ENSMUST00000025989
AA Change: M130V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025989
Gene: ENSMUSG00000025016
AA Change: M130V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:EMP70 55 544 6.2e-164 PFAM
transmembrane domain 549 571 N/A INTRINSIC
Meta Mutation Damage Score 0.7936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Tm9sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Tm9sf3 APN 19 41256276 missense probably damaging 1.00
IGL02176:Tm9sf3 APN 19 41246637 splice site probably benign
PIT4687001:Tm9sf3 UTSW 19 41218191 missense probably damaging 1.00
R0504:Tm9sf3 UTSW 19 41247892 splice site probably benign
R0564:Tm9sf3 UTSW 19 41245525 splice site probably benign
R0586:Tm9sf3 UTSW 19 41256143 critical splice donor site probably null
R1224:Tm9sf3 UTSW 19 41223195 missense probably damaging 1.00
R1533:Tm9sf3 UTSW 19 41238784 missense probably benign 0.00
R1646:Tm9sf3 UTSW 19 41223179 missense possibly damaging 0.79
R1748:Tm9sf3 UTSW 19 41256229 missense probably benign 0.01
R2022:Tm9sf3 UTSW 19 41238792 missense probably damaging 1.00
R2172:Tm9sf3 UTSW 19 41217420 missense probably damaging 1.00
R3844:Tm9sf3 UTSW 19 41217116 missense possibly damaging 0.95
R3878:Tm9sf3 UTSW 19 41246713 missense probably damaging 0.98
R4385:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4582:Tm9sf3 UTSW 19 41256166 missense probably damaging 1.00
R5497:Tm9sf3 UTSW 19 41215116 missense probably benign 0.03
R5876:Tm9sf3 UTSW 19 41240584 missense probably damaging 1.00
R6305:Tm9sf3 UTSW 19 41245442 critical splice donor site probably null
R6924:Tm9sf3 UTSW 19 41218278 missense probably damaging 1.00
R6936:Tm9sf3 UTSW 19 41223199 missense probably benign 0.44
R7121:Tm9sf3 UTSW 19 41245505 nonsense probably null
R7287:Tm9sf3 UTSW 19 41217379 missense probably damaging 1.00
R7303:Tm9sf3 UTSW 19 41238759 missense probably damaging 0.97
R7677:Tm9sf3 UTSW 19 41221304 missense probably damaging 1.00
R8212:Tm9sf3 UTSW 19 41240635 missense probably damaging 0.99
R8220:Tm9sf3 UTSW 19 41215087 missense possibly damaging 0.80
X0026:Tm9sf3 UTSW 19 41246762 missense possibly damaging 0.91
X0026:Tm9sf3 UTSW 19 41246763 nonsense probably null
Z1088:Tm9sf3 UTSW 19 41232378 missense probably damaging 1.00
Z1176:Tm9sf3 UTSW 19 41238809 missense probably damaging 1.00
Z1177:Tm9sf3 UTSW 19 41245445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCCTATAAGGTCTGGCAG -3'
(R):5'- CTGTTGGGAACTGAGGGAACTG -3'

Sequencing Primer
(F):5'- GGTCTGGCAGTATCAAAAATGCCTC -3'
(R):5'- AACTGGGGCAAATGCTGACTTTTC -3'
Posted On2015-07-06