Incidental Mutation 'R2035:Dgcr14'
ID224547
Institutional Source Beutler Lab
Gene Symbol Dgcr14
Ensembl Gene ENSMUSG00000003527
Gene NameDiGeorge syndrome critical region gene 14
SynonymsDgsi, ES2, Es2el, D16H22S1269E
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location17900709-17911348 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 17910086 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003621] [ENSMUST00000003621] [ENSMUST00000012279] [ENSMUST00000232423] [ENSMUST00000232493]
Predicted Effect probably null
Transcript: ENSMUST00000003621
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000003621
SMART Domains Protein: ENSMUSP00000003621
Gene: ENSMUSG00000003527

DomainStartEndE-ValueType
low complexity region 7 34 N/A INTRINSIC
Pfam:Es2 37 405 1.9e-76 PFAM
low complexity region 434 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000012279
SMART Domains Protein: ENSMUSP00000012279
Gene: ENSMUSG00000022738

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
HOX 136 198 2.9e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232366
Predicted Effect probably null
Transcript: ENSMUST00000232423
Predicted Effect probably benign
Transcript: ENSMUST00000232493
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: The human ortholog of this gene is located within the minimal DGS critical region (MDGCR) thought to contain the gene(s) responsible for a group of developmental disorders. These disorders include DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome, and some familial or sporadic conotruncal cardiac defects which have been associated with microdeletion of human chromosome band 22q11.2. The encoded protein localizes to the nucleus, and the orthologous protein in humans co-purifies with C complex spliceosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Dgcr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Dgcr14 APN 16 17902932 missense probably damaging 1.00
IGL02279:Dgcr14 APN 16 17902911 missense possibly damaging 0.95
R0227:Dgcr14 UTSW 16 17902271 missense probably damaging 0.97
R0316:Dgcr14 UTSW 16 17910094 missense probably benign 0.06
R0669:Dgcr14 UTSW 16 17907555 missense probably damaging 1.00
R0880:Dgcr14 UTSW 16 17911187 missense probably damaging 0.96
R1230:Dgcr14 UTSW 16 17909950 missense probably benign 0.00
R1429:Dgcr14 UTSW 16 17902205 nonsense probably null
R1633:Dgcr14 UTSW 16 17909967 missense probably benign 0.03
R1891:Dgcr14 UTSW 16 17907780 nonsense probably null
R2267:Dgcr14 UTSW 16 17909995 missense probably damaging 1.00
R7126:Dgcr14 UTSW 16 17911290 missense unknown
R7804:Dgcr14 UTSW 16 17911167 missense probably damaging 0.96
Z1176:Dgcr14 UTSW 16 17902310 missense possibly damaging 0.85
Z1177:Dgcr14 UTSW 16 17909922 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACCATCATCTAGGTCTCGGC -3'
(R):5'- TCCCAGATGACAACTCTGGC -3'

Sequencing Primer
(F):5'- TCATCTAGGTCTCGGCCCTGG -3'
(R):5'- AGATGACAACTCTGGCCTTTG -3'
Posted On2014-08-25