Mutagenetix > Incidental Mutations

Incidental Mutation 'R2035:Eml5'

224515

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

040042-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R2035 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98794266 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1741 (N1741K)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

Predicted Effect

probably benign
Transcript: ENSMUST00000065716
AA Change: N1694K

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: N1694K

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220848

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221107

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221511

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221902

Predicted Effect

probably benign
Transcript: ENSMUST00000222097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222717

Predicted Effect

probably benign
Transcript: ENSMUST00000223282
AA Change: N1741K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,612,642	*1273Q	probably null	Het
2810474O19Rik	G	A	6: 149,329,226	V1257I	possibly damaging	Het
Aars2	A	G	17: 45,514,801	I348V	possibly damaging	Het
Abca8b	G	A	11: 109,957,106	R788C	possibly damaging	Het
Abhd15	T	C	11: 77,515,710	L171P	probably damaging	Het
Abi3bp	A	T	16: 56,660,218	H686L	probably benign	Het
Acsl1	A	G	8: 46,528,584	Y456C	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Ash1l	T	A	3: 89,066,317	V2561D	probably benign	Het
B3galnt2	T	A	13: 13,966,324	F44I	probably benign	Het
Bicra	A	T	7: 15,996,413	H24Q	possibly damaging	Het
Ccdc163	T	C	4: 116,711,333	S195P	probably damaging	Het
Cd163	A	T	6: 124,320,629	K911N	probably damaging	Het
Clcn3	A	T	8: 60,934,598	S179T	probably damaging	Het
Dctn4	T	A	18: 60,538,417	D120E	possibly damaging	Het
Dgcr14	A	G	16: 17,910,086		probably null	Het
Dnali1	C	T	4: 125,059,110	V207M	probably damaging	Het
Dnhd1	A	G	7: 105,704,921	Q3036R	probably damaging	Het
Dst	G	A	1: 34,271,413	R4098H	probably damaging	Het
Enah	G	A	1: 181,921,972	P415L	probably damaging	Het
F8	ATCTCTCTC	ATCTCTC	X: 75,322,998		probably null	Het
Gm4841	T	G	18: 60,269,857	Y388S	probably benign	Het
Grin3a	T	C	4: 49,771,336	T479A	probably damaging	Het
Gucy2e	C	A	11: 69,227,532	V743L	probably benign	Het
Il33	T	A	19: 29,954,637	N143K	probably damaging	Het
Ism1	T	A	2: 139,757,155	S349R	probably damaging	Het
Itgb2	T	A	10: 77,547,199	D134E	probably damaging	Het
Kcnk1	A	C	8: 126,025,369	N238T	possibly damaging	Het
Kcnu1	G	T	8: 25,896,693	V535L	probably benign	Het
Muc19	T	A	15: 91,892,405		noncoding transcript	Het
Mycbp2	A	T	14: 103,260,239	Y966N	probably damaging	Het
Myo19	A	T	11: 84,897,608	M349L	probably benign	Het
Narf	G	A	11: 121,238,500	A37T	probably benign	Het
Ncapd2	T	C	6: 125,184,528	N208D	probably benign	Het
Nr1i2	A	G	16: 38,251,126		probably null	Het
Olfr1354	T	C	10: 78,917,587	V249A	possibly damaging	Het
Olfr596	T	A	7: 103,310,256	H178Q	probably damaging	Het
Opn5	A	G	17: 42,607,161	I70T	probably damaging	Het
Pkn2	G	T	3: 142,820,587	P410T	probably damaging	Het
Pla2r1	T	C	2: 60,422,736	N1337S	probably damaging	Het
Prkd3	A	T	17: 78,975,373		probably null	Het
Pum2	T	A	12: 8,728,638	Y429*	probably null	Het
Rttn	T	A	18: 89,020,216	V812E	probably damaging	Het
Rufy2	T	A	10: 63,006,747	L483H	probably damaging	Het
Sdccag3	T	A	2: 26,383,627	S374C	probably damaging	Het
Slc35a3	T	A	3: 116,687,323	Q97L	probably damaging	Het
St18	A	T	1: 6,802,328	M96L	probably benign	Het
Strc	G	A	2: 121,374,934	A905V	probably damaging	Het
Syne3	T	C	12: 104,958,127	M338V	probably benign	Het
Syngr2	A	G	11: 117,813,360	D187G	probably benign	Het
Tas2r109	A	C	6: 132,980,460	I169R	probably benign	Het
Tbc1d22a	T	A	15: 86,391,065		probably null	Het
Thbs1	T	A	2: 118,118,340		probably null	Het
Them6	C	A	15: 74,721,675	D127E	probably damaging	Het
Tmem132d	T	C	5: 127,792,458	D604G	probably damaging	Het
Tnni1	A	G	1: 135,805,592	T51A	probably benign	Het
Topors	T	C	4: 40,262,879	N135S	probably damaging	Het
Unc80	A	T	1: 66,606,593	D1476V	probably damaging	Het
Vmn1r17	A	G	6: 57,360,588	V264A	probably benign	Het
Vmn1r193	T	A	13: 22,219,562	T87S	probably benign	Het
Vmn1r202	C	A	13: 22,501,602	R215L	probably damaging	Het
Vmn2r24	A	T	6: 123,816,060	N782I	probably damaging	Het
Vmn2r53	A	G	7: 12,598,511	F404L	possibly damaging	Het
Xpo4	A	T	14: 57,585,926	C1036S	possibly damaging	Het
Yae1d1	T	C	13: 17,989,721	N104D	probably benign	Het
Zan	C	A	5: 137,443,947	R1901L	unknown	Het
Zbtb9	G	A	17: 26,974,923	R434H	probably damaging	Het
Zdhhc23	A	C	16: 43,973,508	C268G	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTAATCTGGATGTATGGGCAAG -3'
(R):5'- GTGAGACTCTGGGACATTGC -3'

Sequencing Primer
(F):5'- TGGTCGCTGTAAAAATGAACTG -3'
(R):5'- CTCTGGGACATTGCTGATAAAGTAG -3'

Posted On

2014-08-25