Incidental Mutation 'R2035:Enah'
ID224419
Institutional Source Beutler Lab
Gene Symbol Enah
Ensembl Gene ENSMUSG00000022995
Gene NameENAH actin regulator
SynonymsNdpp1, Mena
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location181896384-182019990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181921972 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 415 (P415L)
Ref Sequence ENSEMBL: ENSMUSP00000141344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078719] [ENSMUST00000111024] [ENSMUST00000111025] [ENSMUST00000111030] [ENSMUST00000177811] [ENSMUST00000192967] [ENSMUST00000193074] [ENSMUST00000193703] [ENSMUST00000195059]
Predicted Effect probably damaging
Transcript: ENSMUST00000078719
AA Change: P434L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077781
Gene: ENSMUSG00000022995
AA Change: P434L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 154 258 N/A INTRINSIC
low complexity region 274 285 N/A INTRINSIC
low complexity region 308 317 N/A INTRINSIC
internal_repeat_1 354 366 4.73e-6 PROSPERO
low complexity region 373 392 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
low complexity region 430 471 N/A INTRINSIC
low complexity region 487 507 N/A INTRINSIC
low complexity region 542 609 N/A INTRINSIC
low complexity region 665 678 N/A INTRINSIC
internal_repeat_1 746 758 4.73e-6 PROSPERO
Pfam:VASP_tetra 765 801 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111024
SMART Domains Protein: ENSMUSP00000106653
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111025
SMART Domains Protein: ENSMUSP00000106654
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 313 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
Pfam:VASP_tetra 467 506 2.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111030
AA Change: P419L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106659
Gene: ENSMUSG00000022995
AA Change: P419L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 3.87e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 3.87e-6 PROSPERO
Pfam:VASP_tetra 749 788 1.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177811
AA Change: P419L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136863
Gene: ENSMUSG00000022995
AA Change: P419L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 139 243 N/A INTRINSIC
low complexity region 259 270 N/A INTRINSIC
low complexity region 293 302 N/A INTRINSIC
internal_repeat_1 339 351 4.25e-6 PROSPERO
low complexity region 358 377 N/A INTRINSIC
low complexity region 383 405 N/A INTRINSIC
low complexity region 415 456 N/A INTRINSIC
low complexity region 472 492 N/A INTRINSIC
low complexity region 527 594 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
internal_repeat_1 731 743 4.25e-6 PROSPERO
Pfam:VASP_tetra 749 788 2.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192967
SMART Domains Protein: ENSMUSP00000141330
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
SCOP:d1fxkc_ 3 63 1e-3 SMART
low complexity region 70 99 N/A INTRINSIC
low complexity region 118 138 N/A INTRINSIC
low complexity region 173 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193074
SMART Domains Protein: ENSMUSP00000141936
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 7 127 1.5e-4 SMART
WH1 21 128 2.8e-47 SMART
coiled coil region 155 260 N/A INTRINSIC
low complexity region 262 329 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
Pfam:VASP_tetra 484 523 1.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193703
SMART Domains Protein: ENSMUSP00000141462
Gene: ENSMUSG00000022995

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 240 N/A INTRINSIC
low complexity region 279 346 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
Pfam:VASP_tetra 501 540 2.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195059
AA Change: P415L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141344
Gene: ENSMUSG00000022995
AA Change: P415L

DomainStartEndE-ValueType
RanBD 1 107 1.86e-1 SMART
WH1 1 108 3.02e-46 SMART
coiled coil region 135 239 N/A INTRINSIC
low complexity region 255 266 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
internal_repeat_1 335 347 3.85e-6 PROSPERO
low complexity region 354 373 N/A INTRINSIC
low complexity region 379 401 N/A INTRINSIC
low complexity region 411 452 N/A INTRINSIC
low complexity region 468 488 N/A INTRINSIC
low complexity region 523 590 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
internal_repeat_1 727 739 3.85e-6 PROSPERO
Pfam:VASP_tetra 745 784 1.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the enabled/ vasodilator-stimulated phosphoprotein. Members of this gene family are involved in actin-based motility. This protein is involved in regulating the assembly of actin filaments and modulates cell adhesion and motility. Alternate splice variants of this gene have been correlated with tumor invasiveness in certain tissues and these variants may serve as prognostic markers. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a targeted mutation show defects in major axonal projection pathways in brain, including malformation of the hippocampal commissure and pontocerebellar fibers and frequent agenesis of the corpus callosum due to a failure of axons to project across the midline during development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Sdccag3 T A 2: 26,383,627 S374C probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Enah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Enah APN 1 181935696 intron probably benign
IGL01996:Enah APN 1 181956505 missense unknown
R0025:Enah UTSW 1 181913373 missense possibly damaging 0.53
R0612:Enah UTSW 1 181906448 splice site probably benign
R1005:Enah UTSW 1 181961930 splice site probably benign
R1075:Enah UTSW 1 181956501 missense unknown
R1589:Enah UTSW 1 181922293 missense probably damaging 1.00
R1601:Enah UTSW 1 181919620 nonsense probably null
R1607:Enah UTSW 1 181917197 critical splice donor site probably null
R1785:Enah UTSW 1 181956429 missense unknown
R2037:Enah UTSW 1 181921972 missense probably damaging 1.00
R2119:Enah UTSW 1 181921753 missense probably damaging 0.98
R2180:Enah UTSW 1 181918459 missense probably damaging 1.00
R2233:Enah UTSW 1 181921972 missense probably damaging 1.00
R4348:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4350:Enah UTSW 1 181922420 missense possibly damaging 0.94
R4576:Enah UTSW 1 181919563 missense possibly damaging 0.79
R4956:Enah UTSW 1 181918289 missense probably damaging 0.98
R5230:Enah UTSW 1 181935670 intron probably benign
R5282:Enah UTSW 1 181935728 splice site probably null
R5505:Enah UTSW 1 181906453 splice site probably benign
R5813:Enah UTSW 1 181931185 intron probably benign
R6324:Enah UTSW 1 181918571 missense probably damaging 1.00
R6374:Enah UTSW 1 181923580 missense unknown
R6503:Enah UTSW 1 181918511 missense probably damaging 1.00
R6513:Enah UTSW 1 182014355 intron probably benign
R6925:Enah UTSW 1 181905898 critical splice acceptor site probably null
R6925:Enah UTSW 1 181905899 critical splice acceptor site probably null
R7184:Enah UTSW 1 181922392 missense probably damaging 0.99
R7308:Enah UTSW 1 181906385 critical splice donor site probably null
R7453:Enah UTSW 1 181961905 missense unknown
R7759:Enah UTSW 1 181918444 missense unknown
RF024:Enah UTSW 1 181921934 frame shift probably null
RF032:Enah UTSW 1 181921929 frame shift probably null
RF038:Enah UTSW 1 181921935 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAACACTGGGCTTGGATGAG -3'
(R):5'- GTGAACACACCCTCTTCTCAG -3'

Sequencing Primer
(F):5'- CTTGGATGAGGGAGTTGAGGC -3'
(R):5'- AAGTCCTGTGCCTGGCCTAC -3'
Posted On2014-08-25