Incidental Mutation 'R2082:Adat2'
ID230085
Institutional Source Beutler Lab
Gene Symbol Adat2
Ensembl Gene ENSMUSG00000019808
Gene Nameadenosine deaminase, tRNA-specific 2
SynonymsDeadc1, 4933426M09Rik
MMRRC Submission 040087-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R2082 (G1)
Quality Score147
Status Not validated
Chromosome10
Chromosomal Location13552894-13563376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13560163 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 84 (C84Y)
Ref Sequence ENSEMBL: ENSMUSP00000019944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019944]
Predicted Effect probably damaging
Transcript: ENSMUST00000019944
AA Change: C84Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019944
Gene: ENSMUSG00000019808
AA Change: C84Y

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 126 5.3e-23 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,796,379 probably null Het
4933427I04Rik A G 4: 123,860,976 I228V probably benign Het
Aco2 T C 15: 81,913,695 W657R possibly damaging Het
Acsm2 T A 7: 119,580,634 H333Q probably benign Het
Adamts18 C T 8: 113,775,333 V299I probably damaging Het
Arhgef11 C T 3: 87,725,996 T690I possibly damaging Het
Cachd1 A G 4: 101,002,958 D1242G probably damaging Het
Casp14 A G 10: 78,715,033 M106T probably benign Het
Ccdc69 T A 11: 55,052,389 I130F probably damaging Het
Cdk9 A G 2: 32,709,501 L189P probably damaging Het
Cfhr1 C T 1: 139,550,886 V249I possibly damaging Het
Chst1 T C 2: 92,613,990 V269A possibly damaging Het
Col18a1 G T 10: 77,059,293 P1178Q probably damaging Het
Col6a1 A G 10: 76,709,596 L1014P probably damaging Het
Crisp3 T C 17: 40,225,860 Y188C probably damaging Het
Dse G A 10: 34,155,940 R363C probably damaging Het
Exoc5 T C 14: 49,015,587 I525V probably benign Het
Fech A T 18: 64,458,189 I388N probably damaging Het
Fmnl1 T C 11: 103,192,025 L363P probably damaging Het
Gm10842 T A 11: 105,147,083 L64Q unknown Het
Gm8225 C A 17: 26,543,696 P287Q possibly damaging Het
Hsp90aa1 A T 12: 110,692,827 L512H probably damaging Het
Ifi30 T C 8: 70,763,728 probably benign Het
Iqsec1 A T 6: 90,694,574 D115E probably damaging Het
Kcnu1 T A 8: 25,921,549 L174H probably damaging Het
Krt10 A G 11: 99,388,875 V153A probably damaging Het
Krt18 G A 15: 102,031,020 probably null Het
Micu1 A G 10: 59,863,307 T469A probably benign Het
Mtss1l T C 8: 110,726,257 probably null Het
Myo10 T A 15: 25,785,993 F1253L probably damaging Het
N4bp2 A T 5: 65,807,565 T986S probably damaging Het
Naip6 C A 13: 100,304,344 probably null Het
Nphp4 G A 4: 152,559,364 V1117M probably benign Het
Oca2 C A 7: 56,297,137 Q305K probably benign Het
Olfr195 T A 16: 59,148,885 F12I probably damaging Het
Olfr688 C T 7: 105,288,503 Q137* probably null Het
Olfr845 G A 9: 19,339,278 V273I probably benign Het
P2rx7 A T 5: 122,644,095 N8Y possibly damaging Het
Pag1 A T 3: 9,699,485 S203T probably damaging Het
Pfn4 T A 12: 4,775,439 probably null Het
Pip4k2c T C 10: 127,199,089 D414G probably damaging Het
Pkp1 T G 1: 135,884,976 Q329P possibly damaging Het
Polrmt A T 10: 79,743,512 I135N probably benign Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Ppp3cb T C 14: 20,508,678 T439A possibly damaging Het
Prkdc A G 16: 15,715,963 Y1555C probably damaging Het
Ptprh T C 7: 4,550,775 D859G probably damaging Het
Sema5a T A 15: 32,618,856 M510K probably benign Het
Slc22a16 A G 10: 40,585,339 E379G probably benign Het
Slc30a5 C A 13: 100,806,533 probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tbc1d9 A T 8: 83,270,987 S1058C probably damaging Het
Tet2 A G 3: 133,485,727 L982P possibly damaging Het
Tmem101 G T 11: 102,153,377 T228K probably benign Het
Tshz2 G T 2: 169,886,215 K441N probably damaging Het
Upf1 A T 8: 70,341,572 I228N probably damaging Het
Usp32 A T 11: 85,030,512 I692N probably damaging Het
Vmn2r117 A G 17: 23,460,256 S665P possibly damaging Het
Vps13b T C 15: 35,910,746 V3552A possibly damaging Het
Vps35 A T 8: 85,263,465 M638K possibly damaging Het
Vps41 T G 13: 18,852,351 I645S probably benign Het
Zfp703 T C 8: 26,978,988 S227P probably benign Het
Other mutations in Adat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Adat2 APN 10 13560238 missense probably null 1.00
IGL03031:Adat2 APN 10 13556846 unclassified probably benign
R0243:Adat2 UTSW 10 13553293 missense probably benign
R4976:Adat2 UTSW 10 13556906 missense probably damaging 1.00
R5119:Adat2 UTSW 10 13556906 missense probably damaging 1.00
R5298:Adat2 UTSW 10 13556906 missense probably benign 0.04
R7615:Adat2 UTSW 10 13553276 missense probably benign 0.02
R7845:Adat2 UTSW 10 13552997 utr 5 prime probably benign
R7928:Adat2 UTSW 10 13552997 utr 5 prime probably benign
X0061:Adat2 UTSW 10 13561710 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATGATATTTGCACTGGGGAACTG -3'
(R):5'- TCGTGAATCTGGCCATGTTG -3'

Sequencing Primer
(F):5'- GGGCATCCTGAAACCCATGTTC -3'
(R):5'- CATGTTGTGCTCACAGGCAAG -3'
Posted On2014-09-18