Incidental Mutation 'R2100:Emilin1'
ID230423
Institutional Source Beutler Lab
Gene Symbol Emilin1
Ensembl Gene ENSMUSG00000029163
Gene Nameelastin microfibril interfacer 1
Synonyms5830419M17Rik, gp115, EMILIN-1
MMRRC Submission 040104-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2100 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30913402-30921277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 30917897 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 494 (V494G)
Ref Sequence ENSEMBL: ENSMUSP00000031055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031053] [ENSMUST00000031055] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
Predicted Effect probably benign
Transcript: ENSMUST00000031053
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031055
AA Change: V494G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000031055
Gene: ENSMUSG00000029163
AA Change: V494G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 57 128 1.2e-19 PFAM
low complexity region 141 155 N/A INTRINSIC
low complexity region 157 171 N/A INTRINSIC
coiled coil region 174 210 N/A INTRINSIC
coiled coil region 237 263 N/A INTRINSIC
coiled coil region 310 342 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
internal_repeat_1 422 474 9.62e-7 PROSPERO
coiled coil region 527 563 N/A INTRINSIC
low complexity region 606 627 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
internal_repeat_1 704 758 9.62e-7 PROSPERO
low complexity region 780 810 N/A INTRINSIC
Pfam:Collagen 813 870 3.3e-10 PFAM
Pfam:C1q 873 1008 1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201169
Predicted Effect probably benign
Transcript: ENSMUST00000201571
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201621
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202368
Predicted Effect probably benign
Transcript: ENSMUST00000202752
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix glycoprotein that is characterized by an N-terminal microfibril interface domain, a coiled-coiled alpha-helical domain, a collagenous domain and a C-terminal globular C1q domain. The encoded protein associates with elastic fibers at the interface between elastin and microfibrils and may play a role in the development of elastic tissues including large blood vessels, dermis, heart and lung. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display no goss abnormalities. However, histological defects occur in the skin and aorta relating to elastin fiber abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,500,249 N238S probably damaging Het
Abca3 C T 17: 24,408,209 R1295W probably damaging Het
Abca8b A T 11: 109,937,782 I1430N probably damaging Het
Abcb1a A G 5: 8,713,202 T577A probably damaging Het
Arl5b G A 2: 15,073,195 M101I probably benign Het
C1qbp T A 11: 70,978,102 N278I probably benign Het
Cdh1 A T 8: 106,659,668 T408S possibly damaging Het
Cfap54 T A 10: 93,001,937 I1034F possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Chil4 T C 3: 106,214,347 K62R probably benign Het
Crebl2 A G 6: 134,851,203 T113A probably benign Het
Cyp2c69 C A 19: 39,886,686 V8L probably benign Het
Dpp6 A G 5: 27,664,744 R447G probably damaging Het
Efcab6 A T 15: 83,892,967 probably null Het
Enoph1 A G 5: 100,063,786 I181V probably null Het
F3 T C 3: 121,732,433 V215A possibly damaging Het
Fat3 G T 9: 16,377,430 H266N possibly damaging Het
Frmd4a A G 2: 4,606,023 T995A probably damaging Het
Garnl3 T C 2: 33,046,645 T171A probably benign Het
Hspa4l T C 3: 40,772,658 V476A possibly damaging Het
Impg2 A G 16: 56,231,385 probably null Het
Kctd6 T C 14: 8,222,239 L27P possibly damaging Het
Kmt2d G T 15: 98,846,480 probably benign Het
Kremen1 AGGCGG AGGCGGCGG 11: 5,201,788 probably benign Het
Lrig2 A G 3: 104,511,630 L21P possibly damaging Het
Macf1 G A 4: 123,397,906 Q3284* probably null Het
Mnt A G 11: 74,831,351 E8G probably damaging Het
Nbeal1 A G 1: 60,305,271 probably null Het
Nid2 C T 14: 19,778,878 Q331* probably null Het
Nlrx1 A G 9: 44,262,608 L432P probably damaging Het
Nop2 T A 6: 125,140,822 D445E probably damaging Het
Nup62 T C 7: 44,829,497 probably benign Het
Oas2 A G 5: 120,745,675 probably null Het
Olfr1090 A T 2: 86,754,561 M59K possibly damaging Het
Olfr1128 T A 2: 87,544,825 T240S probably damaging Het
Olfr1480 A G 19: 13,530,434 I298V probably benign Het
Olfr1499 A G 19: 13,815,236 M118T possibly damaging Het
Olfr491 A T 7: 108,317,554 Y220F probably benign Het
P3h3 T A 6: 124,845,042 T623S probably damaging Het
Pkp3 T C 7: 141,083,292 V350A probably damaging Het
Plekha3 T A 2: 76,692,663 I225N probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rnf213 A T 11: 119,467,302 K4292* probably null Het
Rtkn T C 6: 83,149,560 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Snx10 T C 6: 51,588,415 Y171H probably damaging Het
Stx12 A T 4: 132,860,602 I173N possibly damaging Het
Thrb T A 14: 18,030,393 M379K possibly damaging Het
Tmem132e T A 11: 82,444,531 V813E probably damaging Het
Tnfsf12 T C 11: 69,687,349 E134G probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpbgl T A 7: 99,626,444 I69F possibly damaging Het
Ythdc1 T A 5: 86,816,685 S130T possibly damaging Het
Zbp1 A G 2: 173,209,244 S278P probably damaging Het
Zfp30 A G 7: 29,793,526 T483A probably benign Het
Zfp322a G A 13: 23,357,290 S94L possibly damaging Het
Zfp646 T G 7: 127,882,187 Y1179D probably damaging Het
Other mutations in Emilin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Emilin1 APN 5 30913902 missense probably damaging 0.97
IGL01100:Emilin1 APN 5 30918404 missense probably benign
IGL02150:Emilin1 APN 5 30920173 missense possibly damaging 0.85
IGL02416:Emilin1 APN 5 30917788 missense possibly damaging 0.92
IGL02973:Emilin1 APN 5 30920663 missense probably damaging 0.97
R0142:Emilin1 UTSW 5 30913920 missense probably benign 0.00
R0419:Emilin1 UTSW 5 30915022 missense probably damaging 1.00
R1580:Emilin1 UTSW 5 30917420 missense probably damaging 0.99
R1679:Emilin1 UTSW 5 30920199 missense probably benign 0.00
R1802:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1803:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R1864:Emilin1 UTSW 5 30918590 missense probably damaging 1.00
R1958:Emilin1 UTSW 5 30917816 missense probably benign 0.03
R2061:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2201:Emilin1 UTSW 5 30915692 missense probably benign 0.33
R2206:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2274:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2275:Emilin1 UTSW 5 30917738 missense possibly damaging 0.68
R2285:Emilin1 UTSW 5 30918200 missense probably damaging 1.00
R2851:Emilin1 UTSW 5 30917165 missense probably benign 0.38
R3706:Emilin1 UTSW 5 30917822 missense possibly damaging 0.47
R4205:Emilin1 UTSW 5 30919899 unclassified probably benign
R4865:Emilin1 UTSW 5 30917784 missense possibly damaging 0.93
R4878:Emilin1 UTSW 5 30917066 missense probably benign
R4981:Emilin1 UTSW 5 30919351 missense probably benign
R5113:Emilin1 UTSW 5 30920620 missense possibly damaging 0.73
R5232:Emilin1 UTSW 5 30916979 missense probably benign 0.00
R5853:Emilin1 UTSW 5 30918622 missense probably damaging 0.98
R6358:Emilin1 UTSW 5 30918218 missense probably damaging 0.98
R6807:Emilin1 UTSW 5 30915527 missense probably benign 0.10
R6932:Emilin1 UTSW 5 30917077 missense probably damaging 1.00
R6955:Emilin1 UTSW 5 30917909 missense probably damaging 1.00
R7047:Emilin1 UTSW 5 30917078 missense probably benign 0.05
R7278:Emilin1 UTSW 5 30920660 missense probably benign 0.32
R7305:Emilin1 UTSW 5 30917089 nonsense probably null
R8087:Emilin1 UTSW 5 30917100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCGCTTCAACTCTACC -3'
(R):5'- CGCAGTAAGATTTCTGCTGCAG -3'

Sequencing Primer
(F):5'- TACCCTAGGTCCCTCAGAGGAG -3'
(R):5'- AGTAAGATTTCTGCTGCAGTCTCC -3'
Posted On2014-09-18