Incidental Mutation 'R2101:Pla1a'
ID230530
Institutional Source Beutler Lab
Gene Symbol Pla1a
Ensembl Gene ENSMUSG00000002847
Gene Namephospholipase A1 member A
SynonymsPs-pla1
MMRRC Submission 040105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2101 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38396117-38433145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38415368 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 135 (N135D)
Ref Sequence ENSEMBL: ENSMUSP00000002926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002926]
Predicted Effect probably damaging
Transcript: ENSMUST00000002926
AA Change: N135D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002926
Gene: ENSMUSG00000002847
AA Change: N135D

DomainStartEndE-ValueType
Pfam:Lipase 15 336 9.4e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232224
Meta Mutation Damage Score 0.5349 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a phospholipase that hydrolyzes fatty acids at the sn-1 position of phosphatidylserine and 1-acyl-2-lysophosphatidylserine. This secreted protein hydrolyzes phosphatidylserine in liposomes. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G A 2: 103,566,862 A46T probably benign Het
Agap3 T A 5: 24,487,799 L47Q probably damaging Het
Apaf1 T G 10: 91,060,080 I377L probably benign Het
Astn2 G A 4: 65,581,686 R937* probably null Het
Cacnb1 A C 11: 98,005,728 V369G probably damaging Het
Cdc42bpa G T 1: 180,146,968 V1464L probably benign Het
Cdkn2aip A T 8: 47,713,001 M90K probably damaging Het
Chd3 A T 11: 69,349,051 D1650E probably benign Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clca2 T C 3: 145,077,938 T639A probably damaging Het
Cluh G T 11: 74,660,502 probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Col11a2 A T 17: 34,052,169 D528V probably damaging Het
Cyfip2 A G 11: 46,242,443 L810P probably damaging Het
D430041D05Rik A G 2: 104,148,830 V2084A probably damaging Het
Dcc G A 18: 71,810,870 H237Y possibly damaging Het
Ddx60 T A 8: 61,940,645 F38L probably damaging Het
Dio2 T C 12: 90,729,823 *130W probably null Het
Dock5 G T 14: 67,794,010 F990L probably benign Het
Dpy19l1 A T 9: 24,482,035 V146E probably damaging Het
Dscam T C 16: 96,610,349 T1776A probably benign Het
Enpep C T 3: 129,298,938 S532N probably benign Het
Gdf6 A G 4: 9,860,025 D369G probably damaging Het
Gm6169 G T 13: 97,099,222 R6S probably damaging Het
Gtf2b T C 3: 142,771,383 probably benign Het
Hmbox1 A G 14: 64,828,579 probably benign Het
Hps3 C A 3: 20,012,783 V540F possibly damaging Het
Hsd3b6 T A 3: 98,806,237 I249F possibly damaging Het
Hunk T A 16: 90,432,500 probably null Het
Kidins220 T A 12: 25,057,423 L1625Q probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Myo10 T A 15: 25,722,259 L186Q probably benign Het
N4bp2 T A 5: 65,790,881 W285R probably damaging Het
Nat8l T C 5: 33,998,372 L124P probably damaging Het
Nemp2 T C 1: 52,641,066 probably null Het
Nkain2 G A 10: 32,329,817 T74I possibly damaging Het
Nol4 A G 18: 22,823,409 S239P probably damaging Het
Olfr1223 T A 2: 89,144,957 E22V probably benign Het
Pcbp3 T C 10: 76,789,755 I152V possibly damaging Het
Pcp4l1 G T 1: 171,175,605 P10Q probably damaging Het
Plb1 T A 5: 32,349,660 M1193K probably damaging Het
Prc1 T C 7: 80,312,284 V73A probably benign Het
Prkd2 T A 7: 16,869,565 W807R probably damaging Het
Ptprb C T 10: 116,315,038 probably benign Het
Rb1cc1 A G 1: 6,249,335 I993V probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rev3l T C 10: 39,828,096 V2046A probably benign Het
Rnpep G T 1: 135,271,617 N334K probably damaging Het
Sarm1 G A 11: 78,475,289 P695S probably damaging Het
Sf3a3 C T 4: 124,718,343 T131I possibly damaging Het
Slc38a10 A T 11: 120,132,741 V283E probably damaging Het
Slco6c1 A T 1: 97,072,870 L552* probably null Het
Tas2r136 T C 6: 132,777,532 M211V probably benign Het
Tax1bp3 G A 11: 73,181,121 D65N probably damaging Het
Tdrd5 A G 1: 156,301,639 F167S probably damaging Het
Tfeb G A 17: 47,789,665 V269M probably damaging Het
Tspan12 A T 6: 21,799,888 F153L probably benign Het
Txnrd1 T G 10: 82,881,739 L186V probably damaging Het
Upk1b A T 16: 38,780,137 C160* probably null Het
Uty T C Y: 1,176,541 Q172R probably damaging Het
Vmn1r23 T C 6: 57,926,452 K114E possibly damaging Het
Vmn2r99 T G 17: 19,377,991 N92K probably damaging Het
Vstm2a T A 11: 16,263,191 M192K probably benign Het
Zc3h12c A G 9: 52,116,421 V547A probably benign Het
Zfp944 T A 17: 22,339,828 N146I probably benign Het
Other mutations in Pla1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pla1a APN 16 38414850 missense probably damaging 1.00
IGL01086:Pla1a APN 16 38407622 missense probably benign 0.02
IGL01126:Pla1a APN 16 38407639 missense probably benign
R1674:Pla1a UTSW 16 38414810 missense probably benign 0.00
R2415:Pla1a UTSW 16 38407750 missense possibly damaging 0.69
R2987:Pla1a UTSW 16 38407742 missense probably damaging 1.00
R4492:Pla1a UTSW 16 38409610 missense probably benign
R5365:Pla1a UTSW 16 38417207 missense probably benign 0.01
R5424:Pla1a UTSW 16 38414775 missense probably damaging 1.00
R6349:Pla1a UTSW 16 38417124 missense probably benign 0.04
R6388:Pla1a UTSW 16 38397472 missense probably benign
R6443:Pla1a UTSW 16 38409587 splice site probably null
R6996:Pla1a UTSW 16 38397468 missense probably benign 0.04
R7021:Pla1a UTSW 16 38400882 missense probably damaging 0.97
R7519:Pla1a UTSW 16 38414846 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCAGCTCCCTAAGAATCCGG -3'
(R):5'- CACTGTATGACTGGCTGTCCTTAG -3'

Sequencing Primer
(F):5'- AAGAATCCGGCTCTGCTTG -3'
(R):5'- TGACTTCTCCGGCTTAGGGAC -3'
Posted On2014-09-18