Incidental Mutation 'R0195:Add1'
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
MMRRC Submission 038454-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R0195 (G1)
Quality Score225
Status Validated
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 34610646 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000052836] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000135321] [ENSMUST00000146295] [ENSMUST00000147574]
Predicted Effect probably benign
Transcript: ENSMUST00000001108
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106

low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052836
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106

low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114335
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106

low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114338
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106

low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114340
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106

low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135321
Predicted Effect probably benign
Transcript: ENSMUST00000146295
SMART Domains Protein: ENSMUSP00000118539
Gene: ENSMUSG00000029106

low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147574
SMART Domains Protein: ENSMUSP00000116075
Gene: ENSMUSG00000029106

low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.4%
Validation Efficiency 98% (156/160)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,512,974 R362P possibly damaging Het
Adam24 T A 8: 40,681,766 W758R probably benign Het
Adam26b G T 8: 43,520,270 T565K probably damaging Het
Adam7 T G 14: 68,527,627 probably benign Het
Adamts19 A G 18: 58,969,870 probably benign Het
Ago1 A G 4: 126,463,691 C64R probably benign Het
Ankrd12 C T 17: 66,049,948 probably null Het
Arhgef33 A G 17: 80,381,434 K820E probably damaging Het
Arl9 T C 5: 77,006,494 V8A probably damaging Het
Aspm T C 1: 139,479,135 L1920P probably damaging Het
Atad2 A G 15: 58,099,954 probably benign Het
Atp2b2 A T 6: 113,793,874 V358E probably benign Het
C3ar1 A C 6: 122,851,155 C34W possibly damaging Het
C6 G A 15: 4,763,471 V353M probably benign Het
Capn7 T C 14: 31,365,581 I593T probably damaging Het
Casc3 T A 11: 98,821,493 D119E probably damaging Het
Ccna1 T A 3: 55,054,364 E45V probably damaging Het
Cdc37 A G 9: 21,142,280 V180A probably benign Het
Cdh23 A G 10: 60,317,059 I2393T probably damaging Het
Cnbd1 T C 4: 18,906,988 probably benign Het
Cngb3 A T 4: 19,280,975 M15L probably benign Het
Crygn A G 5: 24,756,038 M90T possibly damaging Het
Cse1l T A 2: 166,940,088 S661R probably benign Het
D830013O20Rik C T 12: 73,364,321 noncoding transcript Het
Ddx24 C T 12: 103,418,961 probably null Het
Dnah3 A T 7: 120,077,775 probably null Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dnttip2 A T 3: 122,276,161 T342S probably benign Het
Evx2 G T 2: 74,659,044 R125S probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Git1 T A 11: 77,501,073 D240E probably benign Het
Glp2r T A 11: 67,709,708 K438N probably damaging Het
Gm4778 A G 3: 94,265,922 Y79C possibly damaging Het
Hivep1 T A 13: 42,156,153 I623N probably benign Het
Il17re A G 6: 113,466,137 E312G probably damaging Het
Itgb7 G A 15: 102,222,183 probably benign Het
Itpr3 A G 17: 27,114,114 Y1900C probably damaging Het
Krt2 G A 15: 101,813,191 Q472* probably null Het
Krtap5-1 A C 7: 142,296,697 C125G unknown Het
Macf1 A G 4: 123,434,916 S2554P probably damaging Het
March10 C T 11: 105,385,525 G646R probably damaging Het
Mrpl48 A C 7: 100,546,353 probably benign Het
Myo16 A T 8: 10,315,538 probably benign Het
Nrcam A T 12: 44,584,845 E1060D probably benign Het
Nsd3 T A 8: 25,680,693 C731S probably damaging Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Nxnl2 G T 13: 51,171,447 R42L probably damaging Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Orc1 C T 4: 108,614,308 R786* probably null Het
P2ry6 A T 7: 100,938,697 W152R probably damaging Het
Pex5l T C 3: 32,992,953 N283D possibly damaging Het
Pgk2 T C 17: 40,207,731 I269V probably benign Het
Phgdh T G 3: 98,316,550 probably benign Het
Pzp A T 6: 128,487,478 L1362Q probably damaging Het
Rbbp9 T C 2: 144,548,106 probably benign Het
Rffl A G 11: 82,810,163 L244P probably damaging Het
Serpina11 T C 12: 103,985,872 Y213C probably damaging Het
Srsf11 A G 3: 158,036,535 probably benign Het
Sspo T A 6: 48,486,636 V3785E probably benign Het
Svep1 A T 4: 58,089,514 S1632T possibly damaging Het
Tm4sf1 T A 3: 57,293,059 D74V probably damaging Het
Tmprss15 T A 16: 79,034,334 T393S probably benign Het
Tnfaip3 A G 10: 19,005,713 L275P probably damaging Het
Trim30c A G 7: 104,382,429 V393A probably benign Het
Tssk2 T A 16: 17,899,575 S281T probably benign Het
Tubb4a A G 17: 57,081,499 S176P probably damaging Het
Unc45b T A 11: 82,937,828 M785K probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn1r176 G T 7: 23,835,585 Q48K probably benign Het
Vmn2r110 A T 17: 20,574,055 L784Q probably benign Het
Vps13b A G 15: 35,471,899 T783A probably benign Het
Zfp800 A G 6: 28,243,847 M373T probably damaging Het
Zmym1 A G 4: 127,047,911 F895L possibly damaging Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 unclassified probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2965:Add1 UTSW 5 34630714 missense probably benign 0.00
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5646:Add1 UTSW 5 34630680 missense probably benign 0.10
R5993:Add1 UTSW 5 34601533 missense probably damaging 1.00
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6514:Add1 UTSW 5 34605973 missense probably damaging 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
R6659:Add1 UTSW 5 34613295 missense possibly damaging 0.94
R7326:Add1 UTSW 5 34619371 missense probably benign 0.32
R7473:Add1 UTSW 5 34619353 missense possibly damaging 0.84
R8177:Add1 UTSW 5 34616705 missense possibly damaging 0.77
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcctttcttcccagaatttgtg -3'
Posted On2013-04-16