Incidental Mutation 'R7473:Add1'
ID579256
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Nameadducin 1 (alpha)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R7473 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location34573664-34632308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34619353 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 473 (T473A)
Ref Sequence ENSEMBL: ENSMUSP00000109977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000052836] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000135321] [ENSMUST00000201810]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001108
AA Change: T504A

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106
AA Change: T504A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000052836
AA Change: T504A

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106
AA Change: T504A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114335
AA Change: T473A

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114338
AA Change: T473A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114340
AA Change: T473A

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: T473A

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135321
Predicted Effect probably benign
Transcript: ENSMUST00000152805
SMART Domains Protein: ENSMUSP00000121402
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 95 127 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201810
AA Change: T18A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106
AA Change: T18A

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,267,115 S368P possibly damaging Het
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933434E20Rik T C 3: 90,058,653 probably null Het
A630095N17Rik G A 1: 75,232,031 T15I unknown Het
Actr1b A G 1: 36,709,819 V12A probably benign Het
Akap11 A T 14: 78,513,888 V353E Het
Alcam G A 16: 52,452,519 probably benign Het
Alpi A G 1: 87,099,647 probably null Het
Ap3s2 A G 7: 79,916,031 F49S probably damaging Het
Arpc1a A G 5: 145,101,076 K174E probably benign Het
Bbox1 A T 2: 110,265,498 S374T probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bmp2k A G 5: 97,057,012 N402S probably benign Het
Bmper C A 9: 23,375,630 A284D probably benign Het
Bpifb2 A T 2: 153,881,196 H124L possibly damaging Het
Bsn C T 9: 108,112,250 R2101Q probably damaging Het
Cacng1 T A 11: 107,716,192 D67V probably damaging Het
Catsperg1 A G 7: 29,195,478 S565P probably damaging Het
Cep126 C T 9: 8,101,778 E252K probably damaging Het
Cep55 G A 19: 38,069,936 E326K probably damaging Het
Cfap58 T A 19: 47,974,625 Y491* probably null Het
Cpeb2 T C 5: 43,277,505 S747P Het
Cryz T A 3: 154,606,520 S85T probably benign Het
D2hgdh T C 1: 93,838,078 V367A probably damaging Het
Dgkh T C 14: 78,599,043 N703S probably benign Het
Dnah11 T C 12: 117,903,176 S4077G probably benign Het
Dnah14 A G 1: 181,752,139 H3079R probably damaging Het
Dnah2 T A 11: 69,491,658 T1209S probably damaging Het
Dnmt3b A G 2: 153,684,450 D804G probably damaging Het
Ell2 A G 13: 75,750,035 E143G probably damaging Het
Exoc2 A G 13: 30,822,630 probably null Het
Fahd2a A T 2: 127,440,456 I131N probably damaging Het
Fer1l5 A G 1: 36,421,608 N1976D possibly damaging Het
Flt1 A G 5: 147,594,595 S853P probably damaging Het
Frg2f1 C T 4: 119,530,793 V170I probably benign Het
Gcn1l1 G A 5: 115,581,804 V373M probably benign Het
Gm10696 T A 3: 94,176,202 K101* probably null Het
Gm19965 A G 1: 116,821,872 T428A unknown Het
Gm4792 A G 10: 94,293,868 I124T unknown Het
Grik2 A T 10: 49,113,522 C804S probably benign Het
Heatr6 T A 11: 83,781,391 I1075N probably damaging Het
Hunk G A 16: 90,453,700 A211T probably damaging Het
Ighe T C 12: 113,271,356 I395V probably damaging Het
Ino80e A T 7: 126,857,312 S104T probably damaging Het
Inpp4a A G 1: 37,369,453 Y305C probably benign Het
Insrr T A 3: 87,804,531 probably null Het
Itgae T G 11: 73,140,678 D1073E possibly damaging Het
Klf11 G T 12: 24,655,142 probably null Het
Lrguk A T 6: 34,029,695 K80M probably benign Het
Map2 A T 1: 66,415,458 D1169V probably damaging Het
Mpst G T 15: 78,413,526 C248F probably damaging Het
Myo9a C A 9: 59,895,244 Q2005K probably benign Het
Nfatc4 C T 14: 55,831,964 T649I probably benign Het
Nmt1 A G 11: 103,046,400 R88G probably benign Het
Nqo1 G A 8: 107,403,097 probably benign Het
Nudt2 T G 4: 41,477,576 M19R probably benign Het
Olfr102 T A 17: 37,313,631 Y251F probably benign Het
Olfr1497 C T 19: 13,795,162 V150M probably benign Het
Olfr517 T A 7: 108,868,269 K295M probably damaging Het
P2ry1 T A 3: 61,004,088 I216N probably damaging Het
Pcx T A 19: 4,619,561 L823* probably null Het
Pkhd1 A G 1: 20,549,756 V880A probably damaging Het
Plcb1 A T 2: 135,344,276 N721I probably damaging Het
Prdm15 T C 16: 97,821,846 K269E possibly damaging Het
Prl7b1 A G 13: 27,602,013 V224A possibly damaging Het
Reln A G 5: 21,929,127 V2601A probably benign Het
Rspo4 G A 2: 151,873,073 R210Q unknown Het
Slc7a5 A T 8: 121,888,423 D228E probably benign Het
Tas2r115 A G 6: 132,737,251 S246P probably damaging Het
Tenm4 A G 7: 96,774,146 Y716C probably damaging Het
Tgfb3 T C 12: 86,062,149 K269E possibly damaging Het
Thoc6 A G 17: 23,670,867 I27T probably benign Het
Tigd5 G A 15: 75,909,899 G37S probably benign Het
Tmem259 C T 10: 79,979,672 D102N possibly damaging Het
Tpo T G 12: 30,092,590 I712L probably benign Het
Ttn G A 2: 76,870,548 T21M possibly damaging Het
Utp20 A T 10: 88,820,710 probably null Het
Xrcc5 A G 1: 72,312,589 D106G probably damaging Het
Xrn1 T A 9: 95,979,141 F451L probably benign Het
Zar1l T A 5: 150,517,738 D141V probably damaging Het
Zfp27 A T 7: 29,895,899 C214S possibly damaging Het
Znfx1 A T 2: 167,038,824 C1211S probably damaging Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34613358 missense probably damaging 1.00
IGL01370:Add1 APN 5 34630515 missense probably damaging 1.00
IGL01670:Add1 APN 5 34620063 missense probably damaging 1.00
IGL02965:Add1 APN 5 34620123 missense probably damaging 0.99
IGL03178:Add1 APN 5 34614245 unclassified probably null
R0126:Add1 UTSW 5 34613579 missense probably benign 0.04
R0189:Add1 UTSW 5 34616648 missense probably benign 0.01
R0195:Add1 UTSW 5 34610646 unclassified probably benign
R0318:Add1 UTSW 5 34625340 missense probably damaging 0.99
R0605:Add1 UTSW 5 34614224 missense possibly damaging 0.87
R0624:Add1 UTSW 5 34605853 missense probably damaging 1.00
R1514:Add1 UTSW 5 34610617 missense probably benign 0.03
R1573:Add1 UTSW 5 34601396 missense possibly damaging 0.89
R2512:Add1 UTSW 5 34616686 missense probably benign 0.02
R2965:Add1 UTSW 5 34630714 missense probably benign 0.00
R2966:Add1 UTSW 5 34630714 missense probably benign 0.00
R5646:Add1 UTSW 5 34630680 missense probably benign 0.10
R5993:Add1 UTSW 5 34601533 missense probably damaging 1.00
R6356:Add1 UTSW 5 34619396 missense probably null 1.00
R6514:Add1 UTSW 5 34605973 missense probably damaging 1.00
R6536:Add1 UTSW 5 34601436 missense possibly damaging 0.89
R6659:Add1 UTSW 5 34613295 missense possibly damaging 0.94
R7326:Add1 UTSW 5 34619371 missense probably benign 0.32
R8177:Add1 UTSW 5 34616705 missense possibly damaging 0.77
Z1088:Add1 UTSW 5 34613400 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCCATCACTTGCTGTTTG -3'
(R):5'- GTGCTAGAACGTGCACACACTC -3'

Sequencing Primer
(F):5'- ATGGCCACATCACACTCTTATGG -3'
(R):5'- TAGAACGTGCACACACTCTACCC -3'
Posted On2019-10-07