Incidental Mutation 'R0195:Cse1l'
ID 23345
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1-like (S. cerevisiae)
Synonyms Capts, Xpo2, 2610100P18Rik, Cas
MMRRC Submission 038454-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0195 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 166906040-166946389 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 166940088 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 661 (S661R)
Ref Sequence ENSEMBL: ENSMUSP00000129983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: S717R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: S717R

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145819
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: S404R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: S404R

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163917
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: S661R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: S661R

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172037
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.4%
Validation Efficiency 98% (156/160)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,512,974 R362P possibly damaging Het
Adam24 T A 8: 40,681,766 W758R probably benign Het
Adam26b G T 8: 43,520,270 T565K probably damaging Het
Adam7 T G 14: 68,527,627 probably benign Het
Adamts19 A G 18: 58,969,870 probably benign Het
Add1 A G 5: 34,610,646 probably benign Het
Ago1 A G 4: 126,463,691 C64R probably benign Het
Ankrd12 C T 17: 66,049,948 probably null Het
Arhgef33 A G 17: 80,381,434 K820E probably damaging Het
Arl9 T C 5: 77,006,494 V8A probably damaging Het
Aspm T C 1: 139,479,135 L1920P probably damaging Het
Atad2 A G 15: 58,099,954 probably benign Het
Atp2b2 A T 6: 113,793,874 V358E probably benign Het
C3ar1 A C 6: 122,851,155 C34W possibly damaging Het
C6 G A 15: 4,763,471 V353M probably benign Het
Capn7 T C 14: 31,365,581 I593T probably damaging Het
Casc3 T A 11: 98,821,493 D119E probably damaging Het
Ccna1 T A 3: 55,054,364 E45V probably damaging Het
Cdc37 A G 9: 21,142,280 V180A probably benign Het
Cdh23 A G 10: 60,317,059 I2393T probably damaging Het
Cnbd1 T C 4: 18,906,988 probably benign Het
Cngb3 A T 4: 19,280,975 M15L probably benign Het
Crygn A G 5: 24,756,038 M90T possibly damaging Het
D830013O20Rik C T 12: 73,364,321 noncoding transcript Het
Ddx24 C T 12: 103,418,961 probably null Het
Dnah3 A T 7: 120,077,775 probably null Het
Dnah9 C T 11: 65,895,905 G3634E probably benign Het
Dnttip2 A T 3: 122,276,161 T342S probably benign Het
Evx2 G T 2: 74,659,044 R125S probably damaging Het
Fbxl5 A T 5: 43,770,798 L40Q probably damaging Het
Git1 T A 11: 77,501,073 D240E probably benign Het
Glp2r T A 11: 67,709,708 K438N probably damaging Het
Gm4778 A G 3: 94,265,922 Y79C possibly damaging Het
Hivep1 T A 13: 42,156,153 I623N probably benign Het
Il17re A G 6: 113,466,137 E312G probably damaging Het
Itgb7 G A 15: 102,222,183 probably benign Het
Itpr3 A G 17: 27,114,114 Y1900C probably damaging Het
Krt2 G A 15: 101,813,191 Q472* probably null Het
Krtap5-1 A C 7: 142,296,697 C125G unknown Het
Macf1 A G 4: 123,434,916 S2554P probably damaging Het
March10 C T 11: 105,385,525 G646R probably damaging Het
Mrpl48 A C 7: 100,546,353 probably benign Het
Myo16 A T 8: 10,315,538 probably benign Het
Nrcam A T 12: 44,584,845 E1060D probably benign Het
Nsd3 T A 8: 25,680,693 C731S probably damaging Het
Nup85 T G 11: 115,564,531 M1R probably null Het
Nxnl2 G T 13: 51,171,447 R42L probably damaging Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Orc1 C T 4: 108,614,308 R786* probably null Het
P2ry6 A T 7: 100,938,697 W152R probably damaging Het
Pex5l T C 3: 32,992,953 N283D possibly damaging Het
Pgk2 T C 17: 40,207,731 I269V probably benign Het
Phgdh T G 3: 98,316,550 probably benign Het
Pzp A T 6: 128,487,478 L1362Q probably damaging Het
Rbbp9 T C 2: 144,548,106 probably benign Het
Rffl A G 11: 82,810,163 L244P probably damaging Het
Serpina11 T C 12: 103,985,872 Y213C probably damaging Het
Srsf11 A G 3: 158,036,535 probably benign Het
Sspo T A 6: 48,486,636 V3785E probably benign Het
Svep1 A T 4: 58,089,514 S1632T possibly damaging Het
Tm4sf1 T A 3: 57,293,059 D74V probably damaging Het
Tmprss15 T A 16: 79,034,334 T393S probably benign Het
Tnfaip3 A G 10: 19,005,713 L275P probably damaging Het
Trim30c A G 7: 104,382,429 V393A probably benign Het
Tssk2 T A 16: 17,899,575 S281T probably benign Het
Tubb4a A G 17: 57,081,499 S176P probably damaging Het
Unc45b T A 11: 82,937,828 M785K probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn1r176 G T 7: 23,835,585 Q48K probably benign Het
Vmn2r110 A T 17: 20,574,055 L784Q probably benign Het
Vps13b A G 15: 35,471,899 T783A probably benign Het
Zfp800 A G 6: 28,243,847 M373T probably damaging Het
Zmym1 A G 4: 127,047,911 F895L possibly damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166927804 missense probably damaging 1.00
IGL01306:Cse1l APN 2 166927508 nonsense probably null
IGL01672:Cse1l APN 2 166929967 missense probably damaging 1.00
IGL02060:Cse1l APN 2 166930653 missense probably damaging 1.00
IGL02897:Cse1l APN 2 166919708 missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166943057 splice site probably benign
ANU23:Cse1l UTSW 2 166927508 nonsense probably null
PIT4585001:Cse1l UTSW 2 166941474 missense probably damaging 1.00
R1114:Cse1l UTSW 2 166941203 splice site probably benign
R1539:Cse1l UTSW 2 166926372 missense probably benign 0.00
R1721:Cse1l UTSW 2 166926411 missense probably damaging 1.00
R1779:Cse1l UTSW 2 166940124 splice site probably null
R1913:Cse1l UTSW 2 166922191 missense probably damaging 1.00
R2069:Cse1l UTSW 2 166941492 missense probably benign 0.01
R2398:Cse1l UTSW 2 166928997 missense probably damaging 1.00
R4110:Cse1l UTSW 2 166942050 missense probably benign 0.00
R4195:Cse1l UTSW 2 166929979 missense probably damaging 1.00
R4603:Cse1l UTSW 2 166944532 missense probably benign 0.09
R4686:Cse1l UTSW 2 166932160 missense probably damaging 1.00
R4867:Cse1l UTSW 2 166926403 missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166929794 missense probably damaging 1.00
R5164:Cse1l UTSW 2 166944428 missense probably benign 0.02
R5475:Cse1l UTSW 2 166941254 missense probably damaging 1.00
R5493:Cse1l UTSW 2 166941190 intron probably benign
R5782:Cse1l UTSW 2 166929001 missense probably damaging 1.00
R5862:Cse1l UTSW 2 166915207 missense probably benign 0.00
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6030:Cse1l UTSW 2 166919621 missense probably benign 0.01
R6913:Cse1l UTSW 2 166929877 missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166922788 missense probably benign
R7871:Cse1l UTSW 2 166935671 splice site probably null
R8001:Cse1l UTSW 2 166939913 missense probably damaging 1.00
R8057:Cse1l UTSW 2 166939925 missense probably damaging 1.00
R8175:Cse1l UTSW 2 166943208 critical splice donor site probably null
R8347:Cse1l UTSW 2 166927585 missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166919684 missense probably benign 0.00
R8479:Cse1l UTSW 2 166921973 missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166943080 missense probably damaging 1.00
R9206:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9208:Cse1l UTSW 2 166941265 missense probably damaging 1.00
R9522:Cse1l UTSW 2 166934753 missense probably benign
R9599:Cse1l UTSW 2 166941466 missense probably benign
R9600:Cse1l UTSW 2 166915199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTTGTTCCAGAGCCCC -3'
(R):5'- agacgtacttcaacaGCCTCTTACCA -3'

Sequencing Primer
(F):5'- GGGCTGCCACTAACAACTC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On 2013-04-16