Incidental Mutation 'R0195:Cse1l'
ID 23345
Institutional Source Beutler Lab
Gene Symbol Cse1l
Ensembl Gene ENSMUSG00000002718
Gene Name chromosome segregation 1 like
Synonyms Cas, Xpo2, Capts, 2610100P18Rik
MMRRC Submission 038454-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0195 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 166747961-166788309 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 166782008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 661 (S661R)
Ref Sequence ENSEMBL: ENSMUSP00000129983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]
AlphaFold Q9ERK4
Predicted Effect probably benign
Transcript: ENSMUST00000002790
AA Change: S717R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: S717R

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 526 9.2e-169 PFAM
Pfam:CAS_CSE1 527 962 1.1e-181 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145819
Predicted Effect probably benign
Transcript: ENSMUST00000163437
AA Change: S404R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718
AA Change: S404R

DomainStartEndE-ValueType
Pfam:Cse1 1 237 7.9e-105 PFAM
Pfam:CAS_CSE1 225 649 2.3e-195 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163917
Predicted Effect probably benign
Transcript: ENSMUST00000164974
SMART Domains Protein: ENSMUSP00000128515
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
Pfam:CAS_CSE1 24 72 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168599
AA Change: S661R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: S661R

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 256 8.6e-40 PFAM
Pfam:Cse1 255 470 7.3e-99 PFAM
Pfam:CAS_CSE1 471 906 1.3e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172037
Predicted Effect probably benign
Transcript: ENSMUST00000169290
SMART Domains Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718

DomainStartEndE-ValueType
IBN_N 29 102 2e-10 SMART
Pfam:Cse1 156 389 5.2e-102 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.4%
Validation Efficiency 98% (156/160)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C G 11: 100,403,800 (GRCm39) R362P possibly damaging Het
Adam24 T A 8: 41,134,805 (GRCm39) W758R probably benign Het
Adam26b G T 8: 43,973,307 (GRCm39) T565K probably damaging Het
Adam7 T G 14: 68,765,076 (GRCm39) probably benign Het
Adamts19 A G 18: 59,102,942 (GRCm39) probably benign Het
Add1 A G 5: 34,767,990 (GRCm39) probably benign Het
Ago1 A G 4: 126,357,484 (GRCm39) C64R probably benign Het
Ankrd12 C T 17: 66,356,943 (GRCm39) probably null Het
Arhgef33 A G 17: 80,688,863 (GRCm39) K820E probably damaging Het
Arl9 T C 5: 77,154,341 (GRCm39) V8A probably damaging Het
Aspm T C 1: 139,406,873 (GRCm39) L1920P probably damaging Het
Atad2 A G 15: 57,963,350 (GRCm39) probably benign Het
Atp2b2 A T 6: 113,770,835 (GRCm39) V358E probably benign Het
C3ar1 A C 6: 122,828,114 (GRCm39) C34W possibly damaging Het
C6 G A 15: 4,792,953 (GRCm39) V353M probably benign Het
Capn7 T C 14: 31,087,538 (GRCm39) I593T probably damaging Het
Casc3 T A 11: 98,712,319 (GRCm39) D119E probably damaging Het
Ccna1 T A 3: 54,961,785 (GRCm39) E45V probably damaging Het
Cdc37 A G 9: 21,053,576 (GRCm39) V180A probably benign Het
Cdh23 A G 10: 60,152,838 (GRCm39) I2393T probably damaging Het
Cnbd1 T C 4: 18,906,988 (GRCm39) probably benign Het
Cngb3 A T 4: 19,280,975 (GRCm39) M15L probably benign Het
Crygn A G 5: 24,961,036 (GRCm39) M90T possibly damaging Het
D830013O20Rik C T 12: 73,411,095 (GRCm39) noncoding transcript Het
Ddx24 C T 12: 103,385,220 (GRCm39) probably null Het
Dnah3 A T 7: 119,676,998 (GRCm39) probably null Het
Dnah9 C T 11: 65,786,731 (GRCm39) G3634E probably benign Het
Dnttip2 A T 3: 122,069,810 (GRCm39) T342S probably benign Het
Evx2 G T 2: 74,489,388 (GRCm39) R125S probably damaging Het
Fbxl5 A T 5: 43,928,140 (GRCm39) L40Q probably damaging Het
Git1 T A 11: 77,391,899 (GRCm39) D240E probably benign Het
Glp2r T A 11: 67,600,534 (GRCm39) K438N probably damaging Het
Hivep1 T A 13: 42,309,629 (GRCm39) I623N probably benign Het
Il17re A G 6: 113,443,098 (GRCm39) E312G probably damaging Het
Itgb7 G A 15: 102,130,618 (GRCm39) probably benign Het
Itpr3 A G 17: 27,333,088 (GRCm39) Y1900C probably damaging Het
Krt1c G A 15: 101,721,626 (GRCm39) Q472* probably null Het
Krtap5-1 A C 7: 141,850,434 (GRCm39) C125G unknown Het
Macf1 A G 4: 123,328,709 (GRCm39) S2554P probably damaging Het
Marchf10 C T 11: 105,276,351 (GRCm39) G646R probably damaging Het
Mrpl48 A C 7: 100,195,560 (GRCm39) probably benign Het
Myo16 A T 8: 10,365,538 (GRCm39) probably benign Het
Nrcam A T 12: 44,631,628 (GRCm39) E1060D probably benign Het
Nsd3 T A 8: 26,170,709 (GRCm39) C731S probably damaging Het
Nup85 T G 11: 115,455,357 (GRCm39) M1R probably null Het
Nxnl2 G T 13: 51,325,483 (GRCm39) R42L probably damaging Het
Oas3 G A 5: 120,894,210 (GRCm39) R39C probably damaging Het
Or13c25 G A 4: 52,910,849 (GRCm39) T315M probably benign Het
Orc1 C T 4: 108,471,505 (GRCm39) R786* probably null Het
P2ry6 A T 7: 100,587,904 (GRCm39) W152R probably damaging Het
Pex5l T C 3: 33,047,102 (GRCm39) N283D possibly damaging Het
Pgk2 T C 17: 40,518,622 (GRCm39) I269V probably benign Het
Phgdh T G 3: 98,223,866 (GRCm39) probably benign Het
Pzp A T 6: 128,464,441 (GRCm39) L1362Q probably damaging Het
Rbbp9 T C 2: 144,390,026 (GRCm39) probably benign Het
Rffl A G 11: 82,700,989 (GRCm39) L244P probably damaging Het
Serpina11 T C 12: 103,952,131 (GRCm39) Y213C probably damaging Het
Spopfm1 A G 3: 94,173,229 (GRCm39) Y79C possibly damaging Het
Srsf11 A G 3: 157,742,172 (GRCm39) probably benign Het
Sspo T A 6: 48,463,570 (GRCm39) V3785E probably benign Het
Svep1 A T 4: 58,089,514 (GRCm39) S1632T possibly damaging Het
Tm4sf1 T A 3: 57,200,480 (GRCm39) D74V probably damaging Het
Tmprss15 T A 16: 78,831,222 (GRCm39) T393S probably benign Het
Tnfaip3 A G 10: 18,881,461 (GRCm39) L275P probably damaging Het
Trim30c A G 7: 104,031,636 (GRCm39) V393A probably benign Het
Tssk2 T A 16: 17,717,439 (GRCm39) S281T probably benign Het
Tubb4a A G 17: 57,388,499 (GRCm39) S176P probably damaging Het
Unc45b T A 11: 82,828,654 (GRCm39) M785K probably damaging Het
Vldlr A T 19: 27,215,786 (GRCm39) D261V probably damaging Het
Vmn1r176 G T 7: 23,535,010 (GRCm39) Q48K probably benign Het
Vmn2r110 A T 17: 20,794,317 (GRCm39) L784Q probably benign Het
Vps13b A G 15: 35,472,045 (GRCm39) T783A probably benign Het
Zfp800 A G 6: 28,243,846 (GRCm39) M373T probably damaging Het
Zmym1 A G 4: 126,941,704 (GRCm39) F895L possibly damaging Het
Other mutations in Cse1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cse1l APN 2 166,769,724 (GRCm39) missense probably damaging 1.00
IGL01306:Cse1l APN 2 166,769,428 (GRCm39) nonsense probably null
IGL01672:Cse1l APN 2 166,771,887 (GRCm39) missense probably damaging 1.00
IGL02060:Cse1l APN 2 166,772,573 (GRCm39) missense probably damaging 1.00
IGL02897:Cse1l APN 2 166,761,628 (GRCm39) missense possibly damaging 0.47
IGL03375:Cse1l APN 2 166,784,977 (GRCm39) splice site probably benign
ANU23:Cse1l UTSW 2 166,769,428 (GRCm39) nonsense probably null
PIT4585001:Cse1l UTSW 2 166,783,394 (GRCm39) missense probably damaging 1.00
R1114:Cse1l UTSW 2 166,783,123 (GRCm39) splice site probably benign
R1539:Cse1l UTSW 2 166,768,292 (GRCm39) missense probably benign 0.00
R1721:Cse1l UTSW 2 166,768,331 (GRCm39) missense probably damaging 1.00
R1779:Cse1l UTSW 2 166,782,044 (GRCm39) splice site probably null
R1913:Cse1l UTSW 2 166,764,111 (GRCm39) missense probably damaging 1.00
R2069:Cse1l UTSW 2 166,783,412 (GRCm39) missense probably benign 0.01
R2398:Cse1l UTSW 2 166,770,917 (GRCm39) missense probably damaging 1.00
R4110:Cse1l UTSW 2 166,783,970 (GRCm39) missense probably benign 0.00
R4195:Cse1l UTSW 2 166,771,899 (GRCm39) missense probably damaging 1.00
R4603:Cse1l UTSW 2 166,786,452 (GRCm39) missense probably benign 0.09
R4686:Cse1l UTSW 2 166,774,080 (GRCm39) missense probably damaging 1.00
R4867:Cse1l UTSW 2 166,768,323 (GRCm39) missense possibly damaging 0.76
R4942:Cse1l UTSW 2 166,771,714 (GRCm39) missense probably damaging 1.00
R5164:Cse1l UTSW 2 166,786,348 (GRCm39) missense probably benign 0.02
R5475:Cse1l UTSW 2 166,783,174 (GRCm39) missense probably damaging 1.00
R5493:Cse1l UTSW 2 166,783,110 (GRCm39) intron probably benign
R5782:Cse1l UTSW 2 166,770,921 (GRCm39) missense probably damaging 1.00
R5862:Cse1l UTSW 2 166,757,127 (GRCm39) missense probably benign 0.00
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6030:Cse1l UTSW 2 166,761,541 (GRCm39) missense probably benign 0.01
R6913:Cse1l UTSW 2 166,771,797 (GRCm39) missense possibly damaging 0.65
R7683:Cse1l UTSW 2 166,764,708 (GRCm39) missense probably benign
R7871:Cse1l UTSW 2 166,777,591 (GRCm39) splice site probably null
R8001:Cse1l UTSW 2 166,781,833 (GRCm39) missense probably damaging 1.00
R8057:Cse1l UTSW 2 166,781,845 (GRCm39) missense probably damaging 1.00
R8175:Cse1l UTSW 2 166,785,128 (GRCm39) critical splice donor site probably null
R8347:Cse1l UTSW 2 166,769,505 (GRCm39) missense possibly damaging 0.95
R8386:Cse1l UTSW 2 166,761,604 (GRCm39) missense probably benign 0.00
R8479:Cse1l UTSW 2 166,763,893 (GRCm39) missense possibly damaging 0.95
R8973:Cse1l UTSW 2 166,785,000 (GRCm39) missense probably damaging 1.00
R9206:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9208:Cse1l UTSW 2 166,783,185 (GRCm39) missense probably damaging 1.00
R9522:Cse1l UTSW 2 166,776,673 (GRCm39) missense probably benign
R9599:Cse1l UTSW 2 166,783,386 (GRCm39) missense probably benign
R9600:Cse1l UTSW 2 166,757,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTTTGTTCCAGAGCCCC -3'
(R):5'- agacgtacttcaacaGCCTCTTACCA -3'

Sequencing Primer
(F):5'- GGGCTGCCACTAACAACTC -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On 2013-04-16