Incidental Mutation 'R5847:Olfr678'
ID453676
Institutional Source Beutler Lab
Gene Symbol Olfr678
Ensembl Gene ENSMUSG00000073913
Gene Nameolfactory receptor 678
SynonymsMOR32-5, GA_x6K02T2PBJ9-7698491-7699432
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105064475-105071639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105069857 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 130 (Y130F)
Ref Sequence ENSEMBL: ENSMUSP00000150213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098160] [ENSMUST00000213622]
Predicted Effect probably benign
Transcript: ENSMUST00000098160
AA Change: Y130F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095763
Gene: ENSMUSG00000073913
AA Change: Y130F

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 2.2e-115 PFAM
Pfam:7TM_GPCR_Srsx 37 212 2.8e-6 PFAM
Pfam:7tm_1 43 293 8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213622
AA Change: Y130F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Olfr678
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Olfr678 APN 7 105069601 missense probably benign 0.44
IGL01469:Olfr678 APN 7 105070388 missense probably benign 0.05
IGL01726:Olfr678 APN 7 105069629 missense probably damaging 1.00
IGL03263:Olfr678 APN 7 105070002 missense probably damaging 1.00
R1423:Olfr678 UTSW 7 105070019 missense probably damaging 1.00
R2181:Olfr678 UTSW 7 105070211 missense possibly damaging 0.88
R4594:Olfr678 UTSW 7 105069590 missense probably benign 0.00
R5376:Olfr678 UTSW 7 105070357 missense probably damaging 1.00
R5782:Olfr678 UTSW 7 105069749 missense probably damaging 1.00
R6418:Olfr678 UTSW 7 105070307 missense probably damaging 1.00
R6664:Olfr678 UTSW 7 105070188 missense possibly damaging 0.64
R7593:Olfr678 UTSW 7 105069497 missense probably benign 0.27
R8813:Olfr678 UTSW 7 105070311 nonsense probably null
R8841:Olfr678 UTSW 7 105070272 missense possibly damaging 0.69
RF015:Olfr678 UTSW 7 105070048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATCCAAACTGAACGCAGC -3'
(R):5'- AACCCATGTGTTCACAGTAGG -3'

Sequencing Primer
(F):5'- GCATGCACTGATTTGGGCCTATC -3'
(R):5'- ACCCATGTGTTCACAGTAGGTATGTG -3'
Posted On2017-02-10