Incidental Mutation 'R1423:Olfr678'
ID161168
Institutional Source Beutler Lab
Gene Symbol Olfr678
Ensembl Gene ENSMUSG00000073913
Gene Nameolfactory receptor 678
SynonymsMOR32-5, GA_x6K02T2PBJ9-7698491-7699432
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105064475-105071639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 105070019 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 184 (M184R)
Ref Sequence ENSEMBL: ENSMUSP00000150213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098160] [ENSMUST00000213622]
Predicted Effect probably damaging
Transcript: ENSMUST00000098160
AA Change: M184R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095763
Gene: ENSMUSG00000073913
AA Change: M184R

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 2.2e-115 PFAM
Pfam:7TM_GPCR_Srsx 37 212 2.8e-6 PFAM
Pfam:7tm_1 43 293 8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213622
AA Change: M184R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1412 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Olfr678
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Olfr678 APN 7 105069601 missense probably benign 0.44
IGL01469:Olfr678 APN 7 105070388 missense probably benign 0.05
IGL01726:Olfr678 APN 7 105069629 missense probably damaging 1.00
IGL03263:Olfr678 APN 7 105070002 missense probably damaging 1.00
R2181:Olfr678 UTSW 7 105070211 missense possibly damaging 0.88
R4594:Olfr678 UTSW 7 105069590 missense probably benign 0.00
R5376:Olfr678 UTSW 7 105070357 missense probably damaging 1.00
R5782:Olfr678 UTSW 7 105069749 missense probably damaging 1.00
R5847:Olfr678 UTSW 7 105069857 missense probably benign 0.01
R6418:Olfr678 UTSW 7 105070307 missense probably damaging 1.00
R6664:Olfr678 UTSW 7 105070188 missense possibly damaging 0.64
R7593:Olfr678 UTSW 7 105069497 missense probably benign 0.27
RF015:Olfr678 UTSW 7 105070048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATACATGCACTGGCCTGGAG -3'
(R):5'- ACATGACACTGACATGGGAGCCAC -3'

Sequencing Primer
(F):5'- CTGTGGTACTGACAATTATGGC -3'
(R):5'- GAGCCACATGTACTTAGTGCC -3'
Posted On2014-03-14