Incidental Mutation 'R2193:Dab1'
ID238260
Institutional Source Beutler Lab
Gene Symbol Dab1
Ensembl Gene ENSMUSG00000028519
Gene Namedisabled 1
SynonymsC630028C02Rik
MMRRC Submission 040195-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R2193 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location103619359-104744844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104731751 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 524 (A524V)
Ref Sequence ENSEMBL: ENSMUSP00000102443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106830] [ENSMUST00000146078]
Predicted Effect probably benign
Transcript: ENSMUST00000106830
AA Change: A524V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: A524V

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 254 267 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 490 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146078
SMART Domains Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 235 242 N/A INTRINSIC
Meta Mutation Damage Score 0.2232 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp4 T C 7: 44,253,569 R289G probably benign Het
Bfar A G 16: 13,697,471 N183D probably benign Het
Cdca3 A G 6: 124,831,446 T69A probably damaging Het
Ces1b A T 8: 93,079,877 C14S probably benign Het
Clcn3 T A 8: 60,929,187 I456F possibly damaging Het
Dcpp2 A C 17: 23,900,419 D69A probably damaging Het
Dlgap2 T A 8: 14,743,431 I475N possibly damaging Het
Dnah6 T A 6: 73,138,640 M1592L probably damaging Het
Dscaml1 A G 9: 45,685,234 Q792R probably benign Het
Eif2ak4 A G 2: 118,422,266 I440V probably benign Het
Frrs1 T C 3: 116,878,345 S31P probably damaging Het
Isoc2b T C 7: 4,850,824 H117R probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Klf5 C T 14: 99,298,970 probably benign Het
Ltn1 G A 16: 87,427,647 S63F probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Oas1f A C 5: 120,851,585 T196P probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocln T C 13: 100,539,904 D27G probably damaging Het
Olfr1390 A G 11: 49,340,943 H137R possibly damaging Het
Olfr332 A T 11: 58,489,906 M283K probably damaging Het
Rasgrf2 A C 13: 92,023,713 probably null Het
Sars2 G T 7: 28,748,997 V268L probably damaging Het
Sin3a T A 9: 57,117,477 S1040R possibly damaging Het
Vps9d1 A T 8: 123,252,665 Y39N probably damaging Het
Other mutations in Dab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dab1 APN 4 104678810 missense probably damaging 1.00
IGL00087:Dab1 APN 4 104678753 missense possibly damaging 0.90
IGL00328:Dab1 APN 4 104688438 missense possibly damaging 0.55
IGL00756:Dab1 APN 4 104727878 missense probably benign
IGL02074:Dab1 APN 4 104727854 missense possibly damaging 0.90
IGL02286:Dab1 APN 4 104680070 missense probably damaging 1.00
IGL02986:Dab1 APN 4 104479221 missense probably benign 0.00
IGL03008:Dab1 APN 4 104727580 missense probably damaging 0.99
IGL03133:Dab1 APN 4 104727580 missense probably benign 0.41
IGL03375:Dab1 APN 4 104681601 missense possibly damaging 0.70
LCD18:Dab1 UTSW 4 104046572 intron probably benign
R0027:Dab1 UTSW 4 104704199 intron probably benign
R0466:Dab1 UTSW 4 104720550 missense probably benign 0.15
R0838:Dab1 UTSW 4 104731751 missense probably benign 0.29
R0840:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1086:Dab1 UTSW 4 104328572 intron probably benign
R1598:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1640:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1699:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1749:Dab1 UTSW 4 104328298 intron probably benign
R1770:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1846:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1847:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1848:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1885:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1986:Dab1 UTSW 4 104613215 missense probably damaging 0.97
R1990:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2006:Dab1 UTSW 4 104605325 missense probably damaging 1.00
R2030:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2032:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2034:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2061:Dab1 UTSW 4 104678741 missense probably damaging 1.00
R2088:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2089:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2092:Dab1 UTSW 4 104678777 missense probably damaging 1.00
R2194:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2361:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2362:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2391:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2424:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2865:Dab1 UTSW 4 104680146 missense probably benign
R3118:Dab1 UTSW 4 104680069 critical splice acceptor site probably null
R3716:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3718:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3740:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3742:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3965:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4057:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4393:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4396:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4418:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4607:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4608:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4648:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4693:Dab1 UTSW 4 104679553 missense probably damaging 1.00
R4701:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4730:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4760:Dab1 UTSW 4 104732145 missense probably damaging 1.00
R4927:Dab1 UTSW 4 104704252 missense probably benign
R5173:Dab1 UTSW 4 104688448 splice site probably null
R5503:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6199:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6200:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6207:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6224:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6227:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6228:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6229:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6246:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6247:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6248:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6249:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6250:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6258:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6259:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6260:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6505:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6817:Dab1 UTSW 4 104679546 missense probably damaging 1.00
R7305:Dab1 UTSW 4 104713790 missense
R7709:Dab1 UTSW 4 104720559 nonsense probably null
Z1088:Dab1 UTSW 4 104479232 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGGATATAAATGGCTGTGGC -3'
(R):5'- TTACAGGAGGCTGAAACTTCC -3'

Sequencing Primer
(F):5'- GGATATAAATGGCTGTGGCTTATATG -3'
(R):5'- TGAAACTTCCCCCAGAGGATG -3'
Posted On2014-10-02