Incidental Mutation 'R2231:Olfr1445'
ID240067
Institutional Source Beutler Lab
Gene Symbol Olfr1445
Ensembl Gene ENSMUSG00000045126
Gene Nameolfactory receptor 1445
SynonymsGA_x6K02T2RE5P-3213352-3214296, MOR202-7
MMRRC Submission 040232-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R2231 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12883855-12884855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12883949 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 23 (I23V)
Ref Sequence ENSEMBL: ENSMUSP00000058933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049624] [ENSMUST00000216805]
Predicted Effect probably benign
Transcript: ENSMUST00000049624
AA Change: I23V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058933
Gene: ENSMUSG00000045126
AA Change: I23V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-54 PFAM
Pfam:7tm_1 39 288 4.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216805
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr1b G A 1: 36,700,359 R336W probably damaging Het
Alkbh6 G A 7: 30,312,590 probably null Het
Ankrd63 A G 2: 118,703,365 probably benign Het
Arsa T C 15: 89,475,722 M1V probably null Het
Cblb T A 16: 52,194,272 S895T probably benign Het
Cdk8 A T 5: 146,231,604 probably benign Het
Coch G A 12: 51,602,865 V320I probably benign Het
Cyp2c68 T A 19: 39,699,360 S398C probably benign Het
Cyp2e1 T C 7: 140,764,914 S98P probably damaging Het
Dnah5 G A 15: 28,408,417 probably null Het
Eif2b5 T C 16: 20,504,770 Y424H probably benign Het
Enoph1 C T 5: 100,040,277 T20I probably damaging Het
Entpd7 T C 19: 43,721,816 V304A probably benign Het
Fam227a T A 15: 79,615,381 Y591F possibly damaging Het
Gal3st1 T C 11: 3,998,282 I163T probably benign Het
Kif21a G A 15: 90,985,362 Q429* probably null Het
L1cam T A X: 73,861,341 N503I possibly damaging Het
Myl3 T C 9: 110,767,911 L113P probably damaging Het
Nup153 A G 13: 46,709,627 probably null Het
Oaz3 T C 3: 94,434,539 T130A probably benign Het
Olfr140 A T 2: 90,052,225 F33Y probably benign Het
Pacs2 G A 12: 113,063,367 D605N probably damaging Het
Pdk3 G T X: 93,813,998 N59K probably damaging Het
Piezo2 A T 18: 63,145,072 C254S probably damaging Het
Plekhd1 T C 12: 80,721,951 F403L possibly damaging Het
Pou5f1 A G 17: 35,510,062 T134A probably benign Het
Ppp3r1 G A 11: 17,193,115 G68R probably damaging Het
Prr5 T C 15: 84,702,780 S244P probably benign Het
Sacs A G 14: 61,205,929 probably null Het
Sbno1 A T 5: 124,405,704 D257E probably damaging Het
Scn10a T C 9: 119,633,850 E1040G possibly damaging Het
Sgce T C 6: 4,730,066 K53E probably benign Het
Slc6a11 A G 6: 114,194,629 T254A probably damaging Het
Spag1 A G 15: 36,191,167 Y180C probably benign Het
Ssna1 G T 2: 25,272,007 N58K possibly damaging Het
Tbx3 C A 5: 119,677,524 N296K probably damaging Het
Tcerg1 A G 18: 42,524,244 T264A unknown Het
Trdmt1 A T 2: 13,525,625 F82I probably damaging Het
Ttn A T 2: 76,944,153 F2136L probably damaging Het
Usb1 T G 8: 95,344,046 L200R probably damaging Het
Usp33 C T 3: 152,373,386 A425V probably benign Het
Zfp92 G T X: 73,422,752 L450F possibly damaging Het
Zw10 C T 9: 49,064,121 T282M possibly damaging Het
Other mutations in Olfr1445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr1445 APN 19 12883901 missense probably benign 0.03
IGL01786:Olfr1445 APN 19 12884277 missense probably damaging 0.99
IGL02375:Olfr1445 APN 19 12883941 missense probably benign 0.00
IGL03220:Olfr1445 APN 19 12884451 missense possibly damaging 0.80
IGL03232:Olfr1445 APN 19 12884272 nonsense probably null
R0505:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0505:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R0541:Olfr1445 UTSW 19 12884094 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R2187:Olfr1445 UTSW 19 12884255 missense probably damaging 1.00
R3706:Olfr1445 UTSW 19 12883896 missense probably damaging 1.00
R4698:Olfr1445 UTSW 19 12884621 missense probably benign 0.08
R5558:Olfr1445 UTSW 19 12884387 missense probably benign 0.01
R6163:Olfr1445 UTSW 19 12884108 missense probably damaging 1.00
R7057:Olfr1445 UTSW 19 12884642 missense probably damaging 0.98
R7063:Olfr1445 UTSW 19 12884085 missense probably damaging 1.00
R7705:Olfr1445 UTSW 19 12884507 missense probably benign 0.01
R8073:Olfr1445 UTSW 19 12884616 missense probably benign 0.00
R8174:Olfr1445 UTSW 19 12883904 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCTTGAATTTTGCTGCCTC -3'
(R):5'- TTTGGGAGTGACAGCTGAAG -3'

Sequencing Primer
(F):5'- CAGTCTGCTTGGATCAGAATGC -3'
(R):5'- TGACAGCTGAAGAATAACCAAAGTC -3'
Posted On2014-10-15