Incidental Mutation 'R2239:Rgs3'
ID240524
Institutional Source Beutler Lab
Gene Symbol Rgs3
Ensembl Gene ENSMUSG00000059810
Gene Nameregulator of G-protein signaling 3
SynonymsC2pa, PDZ-RGS3, RGS3S, C2PA-RGS3, 4930506N09Rik
MMRRC Submission 040239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R2239 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62559847-62704001 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62625887 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 299 (T299S)
Ref Sequence ENSEMBL: ENSMUSP00000095639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065870] [ENSMUST00000084521] [ENSMUST00000098031] [ENSMUST00000107424]
Predicted Effect probably benign
Transcript: ENSMUST00000065870
AA Change: T307S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065447
Gene: ENSMUSG00000059810
AA Change: T307S

DomainStartEndE-ValueType
C2 47 150 7.98e-15 SMART
PDZ 203 272 8.09e-10 SMART
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084521
AA Change: T130S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081569
Gene: ENSMUSG00000059810
AA Change: T130S

DomainStartEndE-ValueType
PDZ 26 95 8.09e-10 SMART
low complexity region 288 298 N/A INTRINSIC
internal_repeat_1 407 447 2.05e-9 PROSPERO
internal_repeat_1 456 501 2.05e-9 PROSPERO
low complexity region 645 674 N/A INTRINSIC
RGS 841 957 3.66e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098031
AA Change: T299S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095639
Gene: ENSMUSG00000059810
AA Change: T299S

DomainStartEndE-ValueType
C2 39 142 7.98e-15 SMART
PDZ 195 264 8.09e-10 SMART
low complexity region 457 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107424
AA Change: T130S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103047
Gene: ENSMUSG00000059810
AA Change: T130S

DomainStartEndE-ValueType
PDZ 26 95 8.09e-10 SMART
low complexity region 288 298 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154071
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 94% (68/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired T cell migration in model of Th2-mediated airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T C 8: 24,646,287 E406G probably benign Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Arhgap36 G T X: 49,493,405 V60L possibly damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm T A 1: 139,456,846 I127K possibly damaging Het
Atp8b3 A G 10: 80,530,988 C259R probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Ccdc47 G T 11: 106,202,134 N100K possibly damaging Het
Cd200r4 T A 16: 44,820,897 M1K probably null Het
Cdc37 G A 9: 21,142,533 Q176* probably null Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cep128 T C 12: 91,347,567 T146A probably benign Het
Cnnm4 T A 1: 36,505,678 S673T probably benign Het
Cnot1 T C 8: 95,769,521 I342V probably benign Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Dars2 T C 1: 161,063,282 T120A possibly damaging Het
Dnah7b C A 1: 46,201,184 probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Eomes A G 9: 118,482,291 D394G probably damaging Het
Epn1 A G 7: 5,097,602 N518S probably damaging Het
Exoc1 T C 5: 76,559,710 probably benign Het
Fam186a C T 15: 99,954,864 V158M unknown Het
Fryl A G 5: 73,108,547 L477P probably damaging Het
Gbf1 T C 19: 46,163,618 I30T probably benign Het
Gm7534 A C 4: 134,202,205 M263R unknown Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Htatsf1 G T X: 57,066,504 D642Y unknown Het
Ift88 A G 14: 57,455,504 I387V probably damaging Het
Kcnh5 T A 12: 75,007,719 M484L probably benign Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Kdm6a T C X: 18,199,237 F104S probably damaging Het
Kntc1 T C 5: 123,803,670 V1809A possibly damaging Het
Lgr4 T C 2: 110,012,393 Y908H probably damaging Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Map3k1 A C 13: 111,748,944 S1480A probably benign Het
Map7 A T 10: 20,278,282 N715Y unknown Het
Morn4 A G 19: 42,078,032 Y39H possibly damaging Het
Myh14 A T 7: 44,665,183 D105E probably damaging Het
Nfasc T C 1: 132,583,022 probably benign Het
Nfe2l2 G A 2: 75,676,554 P401S probably benign Het
Nt5c1b C A 12: 10,375,558 T309K probably damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1417 T C 19: 11,828,450 D192G probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr205 T A 16: 59,329,375 I45F probably damaging Het
Olfr223 A G 11: 59,589,271 S273P possibly damaging Het
P4hb A G 11: 120,563,282 Y329H probably damaging Het
Papolg A G 11: 23,876,378 Y259H probably damaging Het
Pcgf5 A T 19: 36,437,354 N105I probably damaging Het
Pde4a G A 9: 21,211,268 C820Y probably damaging Het
Phka2 A G X: 160,541,412 E254G probably damaging Het
Phrf1 A G 7: 141,237,692 E138G probably damaging Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc16a8 T C 15: 79,252,947 M88V probably damaging Het
Slc35f4 A G 14: 49,306,203 probably null Het
Spata4 A C 8: 54,602,629 K185T probably benign Het
Spin2c A G X: 153,833,676 I162V probably damaging Het
Stac G A 9: 111,690,122 probably benign Het
Tet1 T C 10: 62,879,734 D94G probably benign Het
Tnfsf11 A T 14: 78,299,981 S81T possibly damaging Het
Topaz1 C T 9: 122,771,147 T984I probably benign Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a C A 1: 188,576,214 T2020K probably benign Het
Zan G A 5: 137,457,837 Q1354* probably null Het
Other mutations in Rgs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rgs3 APN 4 62701180 missense possibly damaging 0.87
IGL00918:Rgs3 APN 4 62701067 missense probably damaging 1.00
IGL01594:Rgs3 APN 4 62619744 missense probably damaging 0.99
IGL01761:Rgs3 APN 4 62652709 splice site probably benign
IGL02995:Rgs3 APN 4 62625847 missense possibly damaging 0.95
IGL03365:Rgs3 APN 4 62689675 missense probably benign
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0158:Rgs3 UTSW 4 62623884 missense probably damaging 1.00
R0609:Rgs3 UTSW 4 62625936 missense probably damaging 1.00
R0633:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0637:Rgs3 UTSW 4 62646673 splice site probably benign
R0893:Rgs3 UTSW 4 62605561 splice site probably null
R1612:Rgs3 UTSW 4 62625935 missense probably damaging 0.99
R1929:Rgs3 UTSW 4 62702147 missense probably damaging 1.00
R2202:Rgs3 UTSW 4 62690504 missense probably damaging 1.00
R2380:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2974:Rgs3 UTSW 4 62640720 missense probably damaging 1.00
R4871:Rgs3 UTSW 4 62631295 missense probably benign 0.01
R5229:Rgs3 UTSW 4 62702187 missense probably damaging 1.00
R5372:Rgs3 UTSW 4 62652697 intron probably benign
R5597:Rgs3 UTSW 4 62623845 missense probably damaging 1.00
R6006:Rgs3 UTSW 4 62623906 missense probably damaging 1.00
R6056:Rgs3 UTSW 4 62625906 missense probably damaging 0.96
R6732:Rgs3 UTSW 4 62602943 missense probably benign 0.00
R6962:Rgs3 UTSW 4 62700715 intron probably benign
R7141:Rgs3 UTSW 4 62690487 missense probably damaging 1.00
R7156:Rgs3 UTSW 4 62617126 missense probably damaging 0.99
R7193:Rgs3 UTSW 4 62615336 missense probably damaging 0.99
R7459:Rgs3 UTSW 4 62625154 missense probably benign 0.01
R7660:Rgs3 UTSW 4 62701112 missense possibly damaging 0.94
R7697:Rgs3 UTSW 4 62657142 missense probably benign 0.00
R8025:Rgs3 UTSW 4 62690594 missense probably damaging 0.97
Z1177:Rgs3 UTSW 4 62631214 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCAAGTCTGAACTCCTCTGTGG -3'
(R):5'- ACACTCAGCTGTCCATACCTG -3'

Sequencing Primer
(F):5'- AACTCCTCTGTGGAATTTCTAGGAGC -3'
(R):5'- CTTCCAGGATTCAGTGGGGC -3'
Posted On2014-10-15