Incidental Mutation 'R2218:Olfr120'
ID241291
Institutional Source Beutler Lab
Gene Symbol Olfr120
Ensembl Gene ENSMUSG00000063994
Gene Nameolfactory receptor 120
SynonymsGA_x6K02T2PSCP-2184981-2185946, MOR263-3
MMRRC Submission 040220-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2218 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37721808-37727220 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37726254 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 77 (I77F)
Ref Sequence ENSEMBL: ENSMUSP00000146861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077498] [ENSMUST00000207771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077498
AA Change: I86F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094931
Gene: ENSMUSG00000063994
AA Change: I86F

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 50 320 1e-5 PFAM
Pfam:7tm_1 56 305 6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207771
AA Change: I77F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,903,862 probably null Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atp13a5 A T 16: 29,321,646 V319D probably damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Brinp1 A G 4: 68,762,715 L526P probably damaging Het
Cacna1d C T 14: 30,123,091 D679N probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Drd2 T C 9: 49,399,794 V115A probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
F13b G T 1: 139,506,844 S116I probably benign Het
Fam206a G T 4: 56,802,693 V26L probably damaging Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gcn1l1 C A 5: 115,619,661 S2475Y probably benign Het
Gls2 T C 10: 128,204,714 L328P probably damaging Het
Gm7535 A G 17: 17,911,674 probably benign Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Iapp G A 6: 142,303,370 A50T probably benign Het
Il10ra T C 9: 45,265,616 D137G probably benign Het
Krt35 T C 11: 100,096,162 S9G probably null Het
Lamc2 T A 1: 153,130,779 R875S probably benign Het
Mcoln1 C A 8: 3,505,813 T36K possibly damaging Het
Muc6 T C 7: 141,646,960 H885R probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Rag1 T C 2: 101,644,146 H217R probably benign Het
Ramp2 A G 11: 101,247,631 E86G probably benign Het
Rcbtb2 T C 14: 73,178,565 probably null Het
Sema5a A T 15: 32,631,309 I613F probably damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Slc39a11 C A 11: 113,559,550 probably null Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tkt G T 14: 30,567,061 probably null Het
Tle1 A T 4: 72,199,319 F35I possibly damaging Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Ttll13 A G 7: 80,252,502 K109R probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp608 T C 18: 54,987,684 N277S probably benign Het
Other mutations in Olfr120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Olfr120 APN 17 37726302 missense probably benign 0.08
IGL01925:Olfr120 APN 17 37726111 missense probably benign 0.18
IGL02901:Olfr120 APN 17 37726420 missense probably damaging 1.00
PIT4687001:Olfr120 UTSW 17 37726191 missense probably benign 0.01
R1645:Olfr120 UTSW 17 37726338 missense probably benign 0.01
R2336:Olfr120 UTSW 17 37726798 missense probably benign 0.07
R4613:Olfr120 UTSW 17 37726696 missense probably damaging 1.00
R5237:Olfr120 UTSW 17 37726377 missense probably damaging 1.00
R5880:Olfr120 UTSW 17 37726654 missense probably benign 0.09
R6187:Olfr120 UTSW 17 37726141 missense probably damaging 0.99
Z1088:Olfr120 UTSW 17 37726092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCAACTGCTCTCTGTGG -3'
(R):5'- GGGAGCATATGGCCATGTAG -3'

Sequencing Primer
(F):5'- CTCTCTGTGGCAGGAAAATAAGTTG -3'
(R):5'- AGCATATGGCCATGTAGCGGTC -3'
Posted On2014-10-15