Incidental Mutation 'R2223:Cradd'
ID241626
Institutional Source Beutler Lab
Gene Symbol Cradd
Ensembl Gene ENSMUSG00000045867
Gene NameCASP2 and RIPK1 domain containing adaptor with death domain
SynonymsRAIDD
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location95174746-95324133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95175873 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 135 (V135G)
Ref Sequence ENSEMBL: ENSMUSP00000152022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053594] [ENSMUST00000217809] [ENSMUST00000220279]
Predicted Effect probably benign
Transcript: ENSMUST00000053594
AA Change: V135G

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000050295
Gene: ENSMUSG00000045867
AA Change: V135G

DomainStartEndE-ValueType
CARD 1 92 2.92e-35 SMART
DEATH 106 198 1.07e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217809
AA Change: V135G

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000220279
AA Change: V135G

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.5180 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a death domain (DD) motif. This protein recruits caspase 2/ICH1 to the cell death signal transduction complex, which includes tumor necrosis factor receptor 1 (TNFR1A) and RIPK1/RIP kinase, and acts in promoting apoptosis. A mutation in this gene was associated with mental retardation. A related pseudogene is found on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Cradd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1155:Cradd UTSW 10 95322724 missense probably benign 0.04
R2221:Cradd UTSW 10 95175873 missense probably benign 0.24
R2697:Cradd UTSW 10 95175945 missense probably damaging 1.00
R5598:Cradd UTSW 10 95175804 nonsense probably null
R5773:Cradd UTSW 10 95175961 missense probably benign 0.03
R6864:Cradd UTSW 10 95175927 missense probably damaging 1.00
R7358:Cradd UTSW 10 95322775 missense probably damaging 0.99
R7920:Cradd UTSW 10 95322711 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTCACTCCAGCATGTG -3'
(R):5'- CCGGAAATAGTCGCCTATCTG -3'

Sequencing Primer
(F):5'- CTGGAGCAGGGAGGGATC -3'
(R):5'- AAATAGTCGCCTATCTGCCCCG -3'
Posted On2014-10-15