Incidental Mutation 'R2223:Magi2'
ID241607
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 2
SynonymsMagi-2, S-SCAM, Acvrinp1
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location19227036-20704792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20465672 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 111 (V111D)
Ref Sequence ENSEMBL: ENSMUSP00000146458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000101558] [ENSMUST00000115267] [ENSMUST00000197354] [ENSMUST00000197443] [ENSMUST00000197553] [ENSMUST00000208219]
Predicted Effect probably damaging
Transcript: ENSMUST00000088516
AA Change: V501D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003
AA Change: V501D

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101558
AA Change: V338D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099094
Gene: ENSMUSG00000040003
AA Change: V338D

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 608 684 4.04e-19 SMART
low complexity region 716 730 N/A INTRINSIC
PDZ 751 832 5.05e-20 SMART
low complexity region 875 886 N/A INTRINSIC
PDZ 970 1044 3.88e-21 SMART
low complexity region 1080 1093 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115267
AA Change: V338D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110922
Gene: ENSMUSG00000040003
AA Change: V338D

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 622 698 4.04e-19 SMART
low complexity region 730 744 N/A INTRINSIC
PDZ 765 846 5.05e-20 SMART
low complexity region 889 900 N/A INTRINSIC
PDZ 984 1058 3.88e-21 SMART
low complexity region 1094 1107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197354
AA Change: V501D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003
AA Change: V501D

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197443
AA Change: V501D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003
AA Change: V501D

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197553
AA Change: V111D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197822
Predicted Effect probably damaging
Transcript: ENSMUST00000208219
AA Change: V111D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20391301 missense probably benign 0.05
IGL02120:Magi2 APN 5 20228453 critical splice donor site probably null
IGL02341:Magi2 APN 5 20466203 missense probably damaging 1.00
IGL02411:Magi2 APN 5 19678709 missense probably damaging 1.00
IGL02657:Magi2 APN 5 19227583 missense probably damaging 0.99
IGL02976:Magi2 APN 5 20534475 missense probably damaging 1.00
IGL03105:Magi2 APN 5 20543618 missense probably damaging 0.97
IGL03246:Magi2 APN 5 20358950 missense probably damaging 1.00
IGL03329:Magi2 APN 5 20466128 missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 19954511 intron probably benign
PIT4519001:Magi2 UTSW 5 20661346 missense probably damaging 1.00
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0352:Magi2 UTSW 5 20065666 missense probably damaging 1.00
R0362:Magi2 UTSW 5 19227575 missense probably damaging 1.00
R0496:Magi2 UTSW 5 20661359 splice site probably benign
R1103:Magi2 UTSW 5 20611103 missense probably damaging 1.00
R1435:Magi2 UTSW 5 20358945 missense probably damaging 1.00
R1583:Magi2 UTSW 5 19227332 missense probably benign 0.30
R1616:Magi2 UTSW 5 20609326 missense probably damaging 1.00
R1643:Magi2 UTSW 5 20705506 unclassified probably benign
R1707:Magi2 UTSW 5 20215493 missense probably damaging 1.00
R1833:Magi2 UTSW 5 19227457 missense probably damaging 1.00
R1837:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1838:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1839:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1847:Magi2 UTSW 5 20602460 missense probably damaging 0.99
R2496:Magi2 UTSW 5 19678752 missense probably benign 0.42
R2504:Magi2 UTSW 5 20358936 missense probably damaging 1.00
R2848:Magi2 UTSW 5 20602461 frame shift probably null
R2879:Magi2 UTSW 5 20602461 frame shift probably null
R2935:Magi2 UTSW 5 20602461 frame shift probably null
R2936:Magi2 UTSW 5 20602461 frame shift probably null
R3694:Magi2 UTSW 5 20602461 frame shift probably null
R3783:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3786:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3787:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3837:Magi2 UTSW 5 20215468 missense probably benign 0.28
R4151:Magi2 UTSW 5 19227292 missense probably damaging 0.97
R4721:Magi2 UTSW 5 20534469 missense probably damaging 1.00
R5005:Magi2 UTSW 5 20534446 missense probably damaging 0.98
R5012:Magi2 UTSW 5 20465620 missense probably damaging 0.99
R5193:Magi2 UTSW 5 20358972 critical splice donor site probably null
R5298:Magi2 UTSW 5 20569162 missense probably damaging 1.00
R5372:Magi2 UTSW 5 20702110 missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20215424 missense probably benign 0.03
R5806:Magi2 UTSW 5 20651204 missense probably benign 0.01
R5924:Magi2 UTSW 5 20611069 missense probably benign 0.00
R5992:Magi2 UTSW 5 19227291 start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20611093 missense probably damaging 1.00
R6073:Magi2 UTSW 5 20569288 missense probably damaging 1.00
R6500:Magi2 UTSW 5 20602347 missense possibly damaging 0.94
R6664:Magi2 UTSW 5 20702397 missense probably benign 0.00
R7229:Magi2 UTSW 5 20465588 missense probably damaging 1.00
R7344:Magi2 UTSW 5 20550240 missense probably benign 0.19
R7448:Magi2 UTSW 5 20358956 missense probably damaging 1.00
R7605:Magi2 UTSW 5 20228385 missense probably damaging 1.00
R7712:Magi2 UTSW 5 20550282 missense possibly damaging 0.78
R7808:Magi2 UTSW 5 20465840 missense probably benign 0.03
X0065:Magi2 UTSW 5 20569178 missense possibly damaging 0.94
Z1176:Magi2 UTSW 5 20702109 missense probably benign 0.32
Z1177:Magi2 UTSW 5 20702412 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCTTGAGTCACCTACAGAG -3'
(R):5'- ATATCTGGGACCGACTGTGAG -3'

Sequencing Primer
(F):5'- GTCCTTGAGTCACCTACAGAGAATTG -3'
(R):5'- ACTGTGAGGTCCGAGAAATGTATTCC -3'
Posted On2014-10-15