Incidental Mutation 'R2287:Pcolce2'
ID244159
Institutional Source Beutler Lab
Gene Symbol Pcolce2
Ensembl Gene ENSMUSG00000015354
Gene Nameprocollagen C-endopeptidase enhancer 2
Synonyms2400001O18Rik, Pcpe2
MMRRC Submission 040286-MU
Accession Numbers

Ncbi RefSeq: NM_029620.2; MGI:1923727

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2287 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location95637601-95698096 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 95678405 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 169 (W169*)
Ref Sequence ENSEMBL: ENSMUSP00000015498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015498]
Predicted Effect probably null
Transcript: ENSMUST00000015498
AA Change: W169*
SMART Domains Protein: ENSMUSP00000015498
Gene: ENSMUSG00000015354
AA Change: W169*

DomainStartEndE-ValueType
CUB 32 143 1.49e-41 SMART
CUB 153 267 2e-42 SMART
low complexity region 268 293 N/A INTRINSIC
C345C 307 412 4.1e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188629
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 3722112
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable abnormalities in thymus or T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(4) Gene trapped(4)

Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Clec4f CTT CT 6: 83,653,265 probably null Het
Dis3l T A 9: 64,307,497 Q930L probably benign Het
Edem2 T C 2: 155,713,359 K275E probably benign Het
Ehf T C 2: 103,267,124 I193V possibly damaging Het
Gsdma3 A G 11: 98,638,004 N428S possibly damaging Het
Gtf2h4 C A 17: 35,671,225 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Naalad2 A T 9: 18,335,021 probably null Het
Ndufa8 C T 2: 36,036,542 A161T probably benign Het
Nlrp14 A T 7: 107,182,662 L355F probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pcnx4 T C 12: 72,575,398 I1047T probably benign Het
Plxdc2 A G 2: 16,512,190 D94G probably benign Het
Rp1 A T 1: 4,345,959 Y1643* probably null Het
Skint4 A G 4: 112,118,205 T121A possibly damaging Het
Speg A G 1: 75,430,465 I3133V possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trim34a T A 7: 104,261,055 S355T probably damaging Het
Trpv6 T G 6: 41,626,111 N276H probably damaging Het
Vps8 T C 16: 21,568,413 V1175A probably damaging Het
Other mutations in Pcolce2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pcolce2 APN 9 95692923 missense probably damaging 0.98
IGL03339:Pcolce2 APN 9 95678340 splice site probably benign
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0019:Pcolce2 UTSW 9 95694964 critical splice acceptor site probably null
R0570:Pcolce2 UTSW 9 95638657 missense probably benign 0.00
R0962:Pcolce2 UTSW 9 95670034 missense probably benign 0.04
R0989:Pcolce2 UTSW 9 95638723 missense probably benign 0.00
R1171:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R1840:Pcolce2 UTSW 9 95670117 missense probably damaging 0.98
R1840:Pcolce2 UTSW 9 95670203 missense probably benign 0.16
R1997:Pcolce2 UTSW 9 95694740 missense probably benign 0.01
R2061:Pcolce2 UTSW 9 95670176 missense probably benign 0.04
R2196:Pcolce2 UTSW 9 95694689 missense probably damaging 0.98
R2922:Pcolce2 UTSW 9 95694714 missense probably damaging 1.00
R4049:Pcolce2 UTSW 9 95638755 missense probably damaging 1.00
R4432:Pcolce2 UTSW 9 95681557 missense probably damaging 0.99
R4639:Pcolce2 UTSW 9 95637877 splice site probably null
R6288:Pcolce2 UTSW 9 95681593 missense probably damaging 0.96
R6625:Pcolce2 UTSW 9 95678439 nonsense probably null
R6883:Pcolce2 UTSW 9 95678343 critical splice acceptor site probably null
R7023:Pcolce2 UTSW 9 95678468 missense probably benign 0.19
R7066:Pcolce2 UTSW 9 95681621 missense probably benign
R7949:Pcolce2 UTSW 9 95694635 missense probably benign 0.11
R8325:Pcolce2 UTSW 9 95692920 missense probably damaging 1.00
R8369:Pcolce2 UTSW 9 95637794 start codon destroyed probably benign
Z1176:Pcolce2 UTSW 9 95637836 missense possibly damaging 0.83
Z1177:Pcolce2 UTSW 9 95678425 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TACAGAGCAGATTGTGTGGTC -3'
(R):5'- TGTGGTCAATTTATACCAGAGGTG -3'

Sequencing Primer
(F):5'- AGGAGAGCCTCTACCATTGC -3'
(R):5'- CAGAGGTGGAGGCTCATACCTTG -3'
Posted On2014-10-30