Incidental Mutation 'R2309:Add2'
ID 244702
Institutional Source Beutler Lab
Gene Symbol Add2
Ensembl Gene ENSMUSG00000030000
Gene Name adducin 2
Synonyms 2900072M03Rik
MMRRC Submission 040308-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.275) question?
Stock # R2309 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 86005663-86101391 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 86073783 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 224 (C224F)
Ref Sequence ENSEMBL: ENSMUSP00000145034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032069] [ENSMUST00000203196] [ENSMUST00000203279] [ENSMUST00000203366] [ENSMUST00000203445] [ENSMUST00000203724] [ENSMUST00000203786] [ENSMUST00000204059] [ENSMUST00000205034]
AlphaFold Q9QYB8
Predicted Effect probably damaging
Transcript: ENSMUST00000032069
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032069
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203196
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145104
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203279
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145452
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 289 1.77e-20 SMART
coiled coil region 310 337 N/A INTRINSIC
low complexity region 439 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203366
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144849
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203445
SMART Domains Protein: ENSMUSP00000145494
Gene: ENSMUSG00000030000

DomainStartEndE-ValueType
Pfam:Aldolase_II 135 184 7.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203529
Predicted Effect probably damaging
Transcript: ENSMUST00000203724
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145296
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203786
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144694
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204059
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145160
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205034
AA Change: C224F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145034
Gene: ENSMUSG00000030000
AA Change: C224F

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the adducin family. Adducins, encoded by alpha, beta and gamma genes, are heteromeric proteins that crosslink actin filaments with spectrin at the cytoskeletal membrane. This protein, primarily found in the brain and hematopoietic cells, is regulated by phosphorylation and calmodulin interactions as it promotes spectrin assembly onto actin filaments, bundles actin and caps barbed ends of actin filaments. In mouse, deficiency of this gene can lead to mild hemolytic anemia and impaired synaptic plasticity. Mutations of this gene in mouse serve as a pathophysiological model for hereditary spherocytosis and hereditary elliptocytosis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display mild anemia with compensated hemolysis, marked alteration in osmotic fragility, predominant presence of elliptocytes in the blood and increased blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 A G 18: 36,757,818 (GRCm39) I837M probably damaging Het
Baat T C 4: 49,499,718 (GRCm39) Y196C probably damaging Het
Cd19 T C 7: 126,013,447 (GRCm39) N114S probably benign Het
Cldn24 T G 8: 48,275,774 (GRCm39) Y199* probably null Het
Il1rl1 A G 1: 40,481,817 (GRCm39) D175G possibly damaging Het
Kcnh8 T A 17: 53,285,067 (GRCm39) D1012E probably damaging Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Med23 T G 10: 24,746,586 (GRCm39) D35E probably damaging Het
Nbeal2 T C 9: 110,455,638 (GRCm39) D2512G probably damaging Het
Nfatc4 A T 14: 56,064,461 (GRCm39) D246V probably damaging Het
Nlrp9c C A 7: 26,077,512 (GRCm39) V757F probably damaging Het
Or12e8 T C 2: 87,188,298 (GRCm39) F170S probably damaging Het
Pcnt T A 10: 76,278,460 (GRCm39) probably benign Het
Qsox2 T C 2: 26,118,445 (GRCm39) I109V possibly damaging Het
Rnf17 A G 14: 56,743,439 (GRCm39) K1335R possibly damaging Het
Serpina6 A G 12: 103,620,438 (GRCm39) Y104H probably benign Het
Serpini2 A G 3: 75,166,997 (GRCm39) S87P probably damaging Het
Setx G A 2: 29,048,916 (GRCm39) V1981M probably damaging Het
Sgpp2 T C 1: 78,393,986 (GRCm39) F330L probably damaging Het
Slc6a6 G C 6: 91,703,177 (GRCm39) W183C possibly damaging Het
Ttll9 A G 2: 152,826,065 (GRCm39) K81E probably damaging Het
Ulbp1 G A 10: 7,397,388 (GRCm39) T239I probably benign Het
Vmn1r230 A G 17: 21,067,492 (GRCm39) H227R probably damaging Het
Wdr17 A T 8: 55,096,283 (GRCm39) F1029I probably benign Het
Other mutations in Add2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:Add2 APN 6 86,084,388 (GRCm39) missense possibly damaging 0.94
IGL02799:Add2 UTSW 6 86,083,234 (GRCm39) missense possibly damaging 0.65
R0012:Add2 UTSW 6 86,075,610 (GRCm39) missense probably damaging 0.98
R0448:Add2 UTSW 6 86,069,901 (GRCm39) missense probably benign 0.05
R0452:Add2 UTSW 6 86,081,611 (GRCm39) nonsense probably null
R0834:Add2 UTSW 6 86,063,899 (GRCm39) missense probably damaging 0.99
R1220:Add2 UTSW 6 86,063,982 (GRCm39) missense possibly damaging 0.92
R1598:Add2 UTSW 6 86,075,628 (GRCm39) missense probably benign 0.03
R1806:Add2 UTSW 6 86,095,639 (GRCm39) missense probably damaging 0.96
R1837:Add2 UTSW 6 86,095,540 (GRCm39) missense probably damaging 1.00
R1959:Add2 UTSW 6 86,073,738 (GRCm39) missense probably damaging 1.00
R1961:Add2 UTSW 6 86,073,738 (GRCm39) missense probably damaging 1.00
R2152:Add2 UTSW 6 86,075,580 (GRCm39) missense probably damaging 1.00
R4744:Add2 UTSW 6 86,087,870 (GRCm39) missense probably damaging 1.00
R4789:Add2 UTSW 6 86,095,752 (GRCm39) missense probably benign 0.04
R4896:Add2 UTSW 6 86,073,728 (GRCm39) missense probably benign 0.03
R4989:Add2 UTSW 6 86,087,840 (GRCm39) missense probably benign 0.10
R5004:Add2 UTSW 6 86,073,728 (GRCm39) missense probably benign 0.03
R5061:Add2 UTSW 6 86,064,029 (GRCm39) splice site probably null
R5068:Add2 UTSW 6 86,084,440 (GRCm39) missense probably damaging 0.97
R5405:Add2 UTSW 6 86,078,179 (GRCm39) missense probably benign 0.09
R5418:Add2 UTSW 6 86,087,894 (GRCm39) missense probably benign 0.00
R5576:Add2 UTSW 6 86,084,457 (GRCm39) critical splice donor site probably null
R5952:Add2 UTSW 6 86,086,728 (GRCm39) missense probably damaging 1.00
R6011:Add2 UTSW 6 86,075,607 (GRCm39) missense probably damaging 1.00
R6031:Add2 UTSW 6 86,075,655 (GRCm39) missense probably damaging 1.00
R6031:Add2 UTSW 6 86,075,655 (GRCm39) missense probably damaging 1.00
R7026:Add2 UTSW 6 86,063,965 (GRCm39) missense probably benign 0.39
R7158:Add2 UTSW 6 86,062,934 (GRCm39) missense probably damaging 1.00
R7387:Add2 UTSW 6 86,062,997 (GRCm39) missense probably damaging 1.00
R7393:Add2 UTSW 6 86,075,629 (GRCm39) nonsense probably null
R7487:Add2 UTSW 6 86,070,432 (GRCm39) missense possibly damaging 0.94
R7511:Add2 UTSW 6 86,075,597 (GRCm39) missense probably benign
R7543:Add2 UTSW 6 86,083,207 (GRCm39) missense probably damaging 1.00
R8186:Add2 UTSW 6 86,085,002 (GRCm39) missense probably benign 0.44
R8205:Add2 UTSW 6 86,063,899 (GRCm39) missense probably damaging 0.99
R9151:Add2 UTSW 6 86,081,459 (GRCm39) splice site probably benign
R9792:Add2 UTSW 6 86,078,135 (GRCm39) critical splice acceptor site probably null
R9793:Add2 UTSW 6 86,078,135 (GRCm39) critical splice acceptor site probably null
Z1088:Add2 UTSW 6 86,062,947 (GRCm39) missense probably damaging 0.98
Z1176:Add2 UTSW 6 86,075,572 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTCCCTGTTGCTGTAC -3'
(R):5'- CTTGGCCTGAGTTCCAGATC -3'

Sequencing Primer
(F):5'- AATGCACTGGGCCCATGTG -3'
(R):5'- CAAATTTCCTGGGACTAGGGTTACAG -3'
Posted On 2014-10-30