Incidental Mutation 'R2369:Zfp11'
ID246425
Institutional Source Beutler Lab
Gene Symbol Zfp11
Ensembl Gene ENSMUSG00000051034
Gene Namezinc finger protein 11
SynonymsZfp-11, Krox-6
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129654593-129670099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129656465 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 644 (P644L)
Ref Sequence ENSEMBL: ENSMUSP00000051861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049778]
Predicted Effect probably benign
Transcript: ENSMUST00000049778
AA Change: P644L

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051861
Gene: ENSMUSG00000051034
AA Change: P644L

DomainStartEndE-ValueType
ZnF_C2H2 57 79 1.03e-2 SMART
ZnF_C2H2 85 107 4.87e-4 SMART
ZnF_C2H2 113 135 2.91e-2 SMART
ZnF_C2H2 141 163 1.1e-2 SMART
ZnF_C2H2 169 191 4.47e-3 SMART
ZnF_C2H2 197 219 6.78e-3 SMART
ZnF_C2H2 225 247 3.39e-3 SMART
ZnF_C2H2 253 275 1.3e-4 SMART
ZnF_C2H2 281 303 8.34e-3 SMART
ZnF_C2H2 309 331 9.08e-4 SMART
ZnF_C2H2 337 359 7.37e-4 SMART
ZnF_C2H2 365 387 4.94e-5 SMART
ZnF_C2H2 393 415 9.58e-3 SMART
ZnF_C2H2 421 443 1.28e-3 SMART
ZnF_C2H2 449 471 6.32e-3 SMART
ZnF_C2H2 477 499 5.5e-3 SMART
ZnF_C2H2 505 527 4.17e-3 SMART
ZnF_C2H2 533 555 3.16e-3 SMART
ZnF_C2H2 561 583 1.45e-2 SMART
ZnF_C2H2 589 611 5.5e-3 SMART
ZnF_C2H2 617 639 1.58e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Other mutations in Zfp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Zfp11 APN 5 129657914 missense probably benign 0.17
R0190:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0239:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0239:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0419:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0423:Zfp11 UTSW 5 129658238 missense possibly damaging 0.88
R0601:Zfp11 UTSW 5 129657907 missense probably damaging 1.00
R0731:Zfp11 UTSW 5 129657264 missense probably damaging 1.00
R0826:Zfp11 UTSW 5 129657525 missense probably benign 0.04
R1467:Zfp11 UTSW 5 129658190 missense probably benign 0.01
R1467:Zfp11 UTSW 5 129658190 missense probably benign 0.01
R1613:Zfp11 UTSW 5 129658367 missense probably benign 0.09
R1711:Zfp11 UTSW 5 129656673 missense probably benign 0.03
R1770:Zfp11 UTSW 5 129657758 missense possibly damaging 0.94
R2155:Zfp11 UTSW 5 129657152 missense probably damaging 1.00
R5597:Zfp11 UTSW 5 129657102 missense probably benign 0.08
R5902:Zfp11 UTSW 5 129657912 missense probably damaging 0.98
R6324:Zfp11 UTSW 5 129656523 missense possibly damaging 0.95
R6768:Zfp11 UTSW 5 129658351 missense probably benign 0.05
R6943:Zfp11 UTSW 5 129658088 missense probably damaging 0.99
R7782:Zfp11 UTSW 5 129656963 missense possibly damaging 0.56
R8144:Zfp11 UTSW 5 129656630 missense possibly damaging 0.93
Z1177:Zfp11 UTSW 5 129657032 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCGTCTCCCCTCATAGATG -3'
(R):5'- AGCTGCTCCTCATACCTGAC -3'

Sequencing Primer
(F):5'- CCCTCATAGATGGGCCTTTTTGG -3'
(R):5'- ACACCAGAGGATCCATGCTGG -3'
Posted On2014-10-30