Incidental Mutation 'R2376:Pck1'
ID248275
Institutional Source Beutler Lab
Gene Symbol Pck1
Ensembl Gene ENSMUSG00000027513
Gene Namephosphoenolpyruvate carboxykinase 1, cytosolic
SynonymsPEPCK, Pck-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2376 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location173153048-173159273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173157116 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 389 (K389R)
Ref Sequence ENSEMBL: ENSMUSP00000029017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029017]
Predicted Effect probably benign
Transcript: ENSMUST00000029017
AA Change: K389R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029017
Gene: ENSMUSG00000027513
AA Change: K389R

DomainStartEndE-ValueType
Pfam:PEPCK 29 619 3.2e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151269
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a main control point for the regulation of gluconeogenesis. The cytosolic enzyme encoded by this gene, along with GTP, catalyzes the formation of phosphoenolpyruvate from oxaloacetate, with the release of carbon dioxide and GDP. The expression of this gene can be regulated by insulin, glucocorticoids, glucagon, cAMP, and diet. Defects in this gene are a cause of cytosolic phosphoenolpyruvate carboxykinase deficiency. A mitochondrial isozyme of the encoded protein also has been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early postnatal lethality, decreased body fat, decreased glycogen levels in the liver, and altered blood chemistry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A T 6: 92,912,831 V254E probably benign Het
Anapc16 T C 10: 59,988,757 E119G possibly damaging Het
Ankrd13d T A 19: 4,272,595 I350F possibly damaging Het
Asb6 A G 2: 30,824,402 M232T probably benign Het
BC030867 A G 11: 102,250,716 D14G probably benign Het
Cacna1g A G 11: 94,465,908 V134A probably damaging Het
Catsperz A T 19: 6,924,898 L76H probably damaging Het
Eno4 T C 19: 58,953,226 V17A probably benign Het
Ltn1 A G 16: 87,420,807 probably null Het
Myh9 G T 15: 77,783,417 D605E probably benign Het
Obscn C T 11: 59,069,124 A3515T probably damaging Het
Pde10a A G 17: 8,930,537 Y407C probably damaging Het
Plce1 G A 19: 38,777,986 V2138I probably benign Het
Pou4f2 T G 8: 78,436,185 S74R unknown Het
Ptpn21 A T 12: 98,688,314 M798K possibly damaging Het
Rhag G T 17: 40,811,363 probably null Het
Utp6 C G 11: 79,955,613 E181Q probably damaging Het
Vcan G T 13: 89,703,410 Q1144K possibly damaging Het
Vmn1r88 T A 7: 13,177,858 V47D probably damaging Het
Other mutations in Pck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Pck1 APN 2 173154118 critical splice donor site probably null
IGL00817:Pck1 APN 2 173153432 missense possibly damaging 0.47
IGL02476:Pck1 APN 2 173158282 missense probably benign
IGL02803:Pck1 APN 2 173156004 missense probably damaging 1.00
IGL02874:Pck1 APN 2 173155249 missense probably damaging 1.00
IGL02886:Pck1 APN 2 173154856 missense probably benign 0.43
Limestone UTSW 2 173158560 missense probably damaging 1.00
limpet UTSW 2 173154012 missense probably damaging 0.99
R0041:Pck1 UTSW 2 173155210 missense probably benign 0.21
R0125:Pck1 UTSW 2 173156081 nonsense probably null
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0238:Pck1 UTSW 2 173157068 missense possibly damaging 0.91
R0373:Pck1 UTSW 2 173153390 start codon destroyed probably null 0.99
R0595:Pck1 UTSW 2 173157029 missense probably damaging 1.00
R1338:Pck1 UTSW 2 173158410 missense probably benign 0.18
R1623:Pck1 UTSW 2 173154718 missense probably benign 0.26
R1752:Pck1 UTSW 2 173157113 missense probably benign 0.00
R2107:Pck1 UTSW 2 173154068 missense probably benign 0.00
R2883:Pck1 UTSW 2 173158575 missense probably benign 0.03
R3508:Pck1 UTSW 2 173158384 missense possibly damaging 0.61
R4718:Pck1 UTSW 2 173155221 missense probably damaging 0.99
R4853:Pck1 UTSW 2 173154714 nonsense probably null
R4907:Pck1 UTSW 2 173157023 missense probably damaging 1.00
R4950:Pck1 UTSW 2 173154827 missense probably benign
R5073:Pck1 UTSW 2 173156977 missense probably benign 0.41
R5134:Pck1 UTSW 2 173153489 missense probably benign 0.23
R5213:Pck1 UTSW 2 173156085 nonsense probably null
R5244:Pck1 UTSW 2 173154863 missense possibly damaging 0.91
R5654:Pck1 UTSW 2 173158560 missense probably damaging 1.00
R5831:Pck1 UTSW 2 173156999 missense probably damaging 1.00
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6030:Pck1 UTSW 2 173154857 missense probably benign 0.40
R6143:Pck1 UTSW 2 173154012 missense probably damaging 0.99
R6276:Pck1 UTSW 2 173157319 missense probably damaging 1.00
R7553:Pck1 UTSW 2 173157067 missense probably benign 0.13
R7860:Pck1 UTSW 2 173155950 missense possibly damaging 0.80
R8076:Pck1 UTSW 2 173155278 missense probably damaging 1.00
R8187:Pck1 UTSW 2 173155240 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCTGGCCTGCAACTTTCCAG -3'
(R):5'- GGTCAATAATGGGGCACTGG -3'

Sequencing Primer
(F):5'- GGCAACTTAAGGGCTATCAACC -3'
(R):5'- ATAATGGGGCACTGGCTGGC -3'
Posted On2014-11-11