Mutagenetix > Incidental Mutation

Incidental Mutation 'R2376:Ptpn21'

248287

Institutional Source

Beutler Lab

Gene Symbol

Ptpn21

Ensembl Gene

ENSMUSG00000021009

Gene Name

protein tyrosine phosphatase, non-receptor type 21

Synonyms

PTPRL10, PTPD1

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R2376 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98643000-98703664 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98654573 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 798 (M798K)

Ref Sequence

ENSEMBL: ENSMUSP00000152639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000085116
AA Change: M798K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: M798K

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170188
AA Change: M798K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: M798K

Domain	Start	End	E-Value	Type
B41	19	222	5.04e-69	SMART
FERM_C	226	312	4.66e-26	SMART
low complexity region	332	343	N/A	INTRINSIC
low complexity region	563	574	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
PTPc	897	1171	7.31e-111	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221148

Predicted Effect

probably benign
Transcript: ENSMUST00000221535

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221932
AA Change: M798K

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223321

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts9	A	T	6: 92,889,812 (GRCm39)	V254E	probably benign	Het
Anapc16	T	C	10: 59,824,579 (GRCm39)	E119G	possibly damaging	Het
Ankrd13d	T	A	19: 4,322,623 (GRCm39)	I350F	possibly damaging	Het
Asb6	A	G	2: 30,714,414 (GRCm39)	M232T	probably benign	Het
Cacna1g	A	G	11: 94,356,734 (GRCm39)	V134A	probably damaging	Het
Catsperz	A	T	19: 6,902,266 (GRCm39)	L76H	probably damaging	Het
Eno4	T	C	19: 58,941,658 (GRCm39)	V17A	probably benign	Het
Hrob	A	G	11: 102,141,542 (GRCm39)	D14G	probably benign	Het
Ltn1	A	G	16: 87,217,695 (GRCm39)		probably null	Het
Myh9	G	T	15: 77,667,617 (GRCm39)	D605E	probably benign	Het
Obscn	C	T	11: 58,959,950 (GRCm39)	A3515T	probably damaging	Het
Pck1	A	G	2: 172,998,909 (GRCm39)	K389R	probably benign	Het
Pde10a	A	G	17: 9,149,369 (GRCm39)	Y407C	probably damaging	Het
Plce1	G	A	19: 38,766,430 (GRCm39)	V2138I	probably benign	Het
Pou4f2	T	G	8: 79,162,814 (GRCm39)	S74R	unknown	Het
Rhag	G	T	17: 41,122,254 (GRCm39)		probably null	Het
Utp6	C	G	11: 79,846,439 (GRCm39)	E181Q	probably damaging	Het
Vcan	G	T	13: 89,851,529 (GRCm39)	Q1144K	possibly damaging	Het
Vmn1r88	T	A	7: 12,911,785 (GRCm39)	V47D	probably damaging	Het

Other mutations in Ptpn21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Ptpn21	APN	12	98,646,727 (GRCm39)	missense	probably damaging	1.00
IGL00576:Ptpn21	APN	12	98,699,860 (GRCm39)	missense	probably damaging	1.00
IGL00577:Ptpn21	APN	12	98,699,860 (GRCm39)	missense	probably damaging	1.00
IGL00580:Ptpn21	APN	12	98,699,860 (GRCm39)	missense	probably damaging	1.00
IGL00583:Ptpn21	APN	12	98,699,860 (GRCm39)	missense	probably damaging	1.00
IGL00773:Ptpn21	APN	12	98,654,572 (GRCm39)	missense	probably benign	0.00
IGL00780:Ptpn21	APN	12	98,646,630 (GRCm39)	missense	probably damaging	1.00
IGL01516:Ptpn21	APN	12	98,681,448 (GRCm39)	missense	probably damaging	1.00
IGL01616:Ptpn21	APN	12	98,646,272 (GRCm39)	missense	probably damaging	1.00
IGL01939:Ptpn21	APN	12	98,655,420 (GRCm39)	missense	probably damaging	0.96
IGL02237:Ptpn21	APN	12	98,671,351 (GRCm39)	critical splice donor site	probably null
IGL02512:Ptpn21	APN	12	98,645,651 (GRCm39)	missense	probably benign	0.00
IGL02852:Ptpn21	APN	12	98,681,454 (GRCm39)	critical splice acceptor site	probably null
IGL02894:Ptpn21	APN	12	98,655,891 (GRCm39)	splice site	probably benign
IGL03024:Ptpn21	APN	12	98,646,315 (GRCm39)	missense	probably benign
IGL03220:Ptpn21	APN	12	98,644,882 (GRCm39)	missense	probably damaging	1.00
R0144:Ptpn21	UTSW	12	98,654,868 (GRCm39)	missense	probably benign	0.01
R0472:Ptpn21	UTSW	12	98,670,499 (GRCm39)	splice site	probably benign
R0675:Ptpn21	UTSW	12	98,654,475 (GRCm39)	missense	probably benign	0.16
R0771:Ptpn21	UTSW	12	98,655,339 (GRCm39)	missense	probably damaging	1.00
R1434:Ptpn21	UTSW	12	98,654,849 (GRCm39)	missense	probably damaging	1.00
R1470:Ptpn21	UTSW	12	98,654,735 (GRCm39)	missense	probably benign
R1470:Ptpn21	UTSW	12	98,654,735 (GRCm39)	missense	probably benign
R1837:Ptpn21	UTSW	12	98,699,885 (GRCm39)	missense	probably damaging	0.99
R1897:Ptpn21	UTSW	12	98,646,664 (GRCm39)	splice site	probably null
R2048:Ptpn21	UTSW	12	98,655,785 (GRCm39)	missense	possibly damaging	0.94
R3709:Ptpn21	UTSW	12	98,654,800 (GRCm39)	missense	probably benign
R4197:Ptpn21	UTSW	12	98,646,397 (GRCm39)	missense	probably damaging	1.00
R4283:Ptpn21	UTSW	12	98,699,734 (GRCm39)	missense	probably damaging	0.99
R4368:Ptpn21	UTSW	12	98,644,852 (GRCm39)	missense	probably damaging	1.00
R4397:Ptpn21	UTSW	12	98,681,319 (GRCm39)	missense	probably damaging	0.98
R4397:Ptpn21	UTSW	12	98,654,507 (GRCm39)	missense	probably damaging	1.00
R4703:Ptpn21	UTSW	12	98,645,651 (GRCm39)	missense	probably benign	0.00
R4737:Ptpn21	UTSW	12	98,675,103 (GRCm39)	missense	probably benign	0.03
R4829:Ptpn21	UTSW	12	98,655,555 (GRCm39)	missense	probably damaging	1.00
R4926:Ptpn21	UTSW	12	98,681,454 (GRCm39)	critical splice acceptor site	probably null
R4974:Ptpn21	UTSW	12	98,646,362 (GRCm39)	missense	probably damaging	1.00
R5022:Ptpn21	UTSW	12	98,645,666 (GRCm39)	missense	probably damaging	1.00
R5057:Ptpn21	UTSW	12	98,645,666 (GRCm39)	missense	probably damaging	1.00
R5395:Ptpn21	UTSW	12	98,681,376 (GRCm39)	missense	probably damaging	1.00
R5608:Ptpn21	UTSW	12	98,655,036 (GRCm39)	missense	probably benign	0.00
R5741:Ptpn21	UTSW	12	98,645,548 (GRCm39)	missense	probably damaging	1.00
R5785:Ptpn21	UTSW	12	98,648,809 (GRCm39)	missense	probably damaging	0.99
R5959:Ptpn21	UTSW	12	98,675,148 (GRCm39)	splice site	probably null
R5968:Ptpn21	UTSW	12	98,677,149 (GRCm39)	missense	probably damaging	1.00
R5984:Ptpn21	UTSW	12	98,655,335 (GRCm39)	missense	probably damaging	1.00
R6005:Ptpn21	UTSW	12	98,644,811 (GRCm39)	makesense	probably null
R6181:Ptpn21	UTSW	12	98,666,258 (GRCm39)	missense	probably damaging	0.99
R6226:Ptpn21	UTSW	12	98,681,431 (GRCm39)	missense	probably damaging	1.00
R6226:Ptpn21	UTSW	12	98,646,375 (GRCm39)	missense	probably benign	0.24
R6317:Ptpn21	UTSW	12	98,655,521 (GRCm39)	missense	probably damaging	1.00
R6370:Ptpn21	UTSW	12	98,655,293 (GRCm39)	missense	possibly damaging	0.86
R6485:Ptpn21	UTSW	12	98,665,131 (GRCm39)	nonsense	probably null
R6894:Ptpn21	UTSW	12	98,681,440 (GRCm39)	missense	probably damaging	1.00
R7122:Ptpn21	UTSW	12	98,655,171 (GRCm39)	missense	probably damaging	0.99
R7232:Ptpn21	UTSW	12	98,654,996 (GRCm39)	missense	probably benign	0.17
R7289:Ptpn21	UTSW	12	98,670,450 (GRCm39)	missense	probably benign	0.35
R7327:Ptpn21	UTSW	12	98,646,360 (GRCm39)	missense	probably damaging	1.00
R7474:Ptpn21	UTSW	12	98,703,622 (GRCm39)	critical splice donor site	probably null
R7748:Ptpn21	UTSW	12	98,655,031 (GRCm39)	missense	probably benign	0.01
R7816:Ptpn21	UTSW	12	98,648,791 (GRCm39)	missense	probably damaging	1.00
R7867:Ptpn21	UTSW	12	98,671,435 (GRCm39)	missense	probably damaging	1.00
R7878:Ptpn21	UTSW	12	98,681,387 (GRCm39)	missense	probably damaging	1.00
R7911:Ptpn21	UTSW	12	98,655,101 (GRCm39)	missense	probably damaging	0.99
R8100:Ptpn21	UTSW	12	98,648,881 (GRCm39)	missense	possibly damaging	0.61
R8199:Ptpn21	UTSW	12	98,644,841 (GRCm39)	missense	possibly damaging	0.92
R8272:Ptpn21	UTSW	12	98,654,789 (GRCm39)	missense	probably benign
R8481:Ptpn21	UTSW	12	98,655,153 (GRCm39)	missense	probably benign	0.03
R8535:Ptpn21	UTSW	12	98,646,285 (GRCm39)	missense	probably damaging	0.98
R8775:Ptpn21	UTSW	12	98,649,001 (GRCm39)	critical splice acceptor site	probably null
R8775-TAIL:Ptpn21	UTSW	12	98,649,001 (GRCm39)	critical splice acceptor site	probably null
R8929:Ptpn21	UTSW	12	98,655,396 (GRCm39)	missense	probably damaging	0.99
R8969:Ptpn21	UTSW	12	98,655,284 (GRCm39)	missense	probably benign	0.39
R9189:Ptpn21	UTSW	12	98,655,261 (GRCm39)	missense	probably damaging	1.00
R9781:Ptpn21	UTSW	12	98,655,170 (GRCm39)	missense	probably damaging	1.00
Z1177:Ptpn21	UTSW	12	98,654,717 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGAAAACACAGATTAAGGGCCC -3'
(R):5'- CATCTCAGCTGTGTCTGAGC -3'

Sequencing Primer
(F):5'- CACCCTCCATGTCTGAGGCAC -3'
(R):5'- GCCGCTTTCTCTCAGGAACTAAAC -3'

Posted On

2014-11-11