Incidental Mutation 'R2400:Mmp11'
ID248657
Institutional Source Beutler Lab
Gene Symbol Mmp11
Ensembl Gene ENSMUSG00000000901
Gene Namematrix metallopeptidase 11
SynonymsST3, stromelysin 3, Stmy3
MMRRC Submission 040366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2400 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75923222-75936496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75925510 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 419 (T419S)
Ref Sequence ENSEMBL: ENSMUSP00000112940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000924] [ENSMUST00000000925] [ENSMUST00000120281] [ENSMUST00000121304] [ENSMUST00000132869] [ENSMUST00000140388] [ENSMUST00000219728]
Predicted Effect probably benign
Transcript: ENSMUST00000000924
AA Change: T419S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000924
Gene: ENSMUSG00000000901
AA Change: T419S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000925
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120281
AA Change: T419S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112940
Gene: ENSMUSG00000000901
AA Change: T419S

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121304
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133897
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect unknown
Transcript: ENSMUST00000152222
AA Change: T56S
SMART Domains Protein: ENSMUSP00000116279
Gene: ENSMUSG00000000901
AA Change: T56S

DomainStartEndE-ValueType
Blast:HX 2 26 1e-8 BLAST
HX 29 76 7.63e-11 SMART
HX 78 117 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219728
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of endopeptidases that are involved in remodeling extracellular matrix during, for example, embryonic development and tumor progression. The encoded protein undergoes post-translational proteolytic processing by furin endopeptidase to form an active enzyme. Subcutaneous introduction of cells expressing the encoded protein into nude mice results in increased tumor incidence. Mice lacking the encoded protein exhibit a decreased incidence of chemically-induced tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice exhibit a decreased incidence of DMBA-induced carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7530416G11Rik T C 15: 85,493,365 T133A unknown Het
Adgrl2 G T 3: 148,851,934 S519R probably damaging Het
AU041133 A T 10: 82,150,908 K132* probably null Het
Bhlhe22 A G 3: 18,055,451 N222D probably damaging Het
Cep72 C A 13: 74,048,977 A69S probably damaging Het
Csn1s2a T A 5: 87,780,155 probably null Het
Dapk1 T A 13: 60,752,216 F872I probably benign Het
Dhx57 T C 17: 80,260,416 D746G probably damaging Het
Dnah17 T A 11: 118,126,384 probably null Het
Fgg A G 3: 83,008,187 D37G possibly damaging Het
Fnip2 G T 3: 79,479,634 S958R probably benign Het
Gfpt1 A G 6: 87,087,348 D640G probably damaging Het
Golgb1 C A 16: 36,918,466 T2389K possibly damaging Het
Hmgcl C A 4: 135,952,368 probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Nkiras1 T A 14: 18,280,011 V108E possibly damaging Het
Pcsk1 T C 13: 75,090,126 L22P probably benign Het
Rnf213 T C 11: 119,443,195 Y3077H probably damaging Het
Sec62 A G 3: 30,810,532 N182D unknown Het
Serpinb5 A G 1: 106,881,952 T363A probably damaging Het
Usf3 T A 16: 44,215,747 S197T probably benign Het
Vmn2r11 T A 5: 109,052,062 E508D probably benign Het
Wdr81 A G 11: 75,449,035 F1376L probably benign Het
Zfp260 T C 7: 30,104,701 S9P possibly damaging Het
Other mutations in Mmp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Mmp11 APN 10 75926821 missense probably benign 0.00
IGL01690:Mmp11 APN 10 75926896 missense probably damaging 1.00
IGL01804:Mmp11 APN 10 75928470 missense probably benign
R0285:Mmp11 UTSW 10 75925668 missense probably damaging 1.00
R0491:Mmp11 UTSW 10 75926758 missense probably benign 0.04
R0541:Mmp11 UTSW 10 75926933 missense probably damaging 1.00
R1857:Mmp11 UTSW 10 75928357 missense probably benign 0.01
R2442:Mmp11 UTSW 10 75927245 missense probably benign 0.09
R3157:Mmp11 UTSW 10 75927114 unclassified probably benign
R3158:Mmp11 UTSW 10 75927114 unclassified probably benign
R3159:Mmp11 UTSW 10 75927114 unclassified probably benign
R4915:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R4917:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R5137:Mmp11 UTSW 10 75925456 missense probably damaging 1.00
R5848:Mmp11 UTSW 10 75927389 missense probably damaging 1.00
R6156:Mmp11 UTSW 10 75926491 missense probably damaging 1.00
R6313:Mmp11 UTSW 10 75923984 makesense probably null
R6569:Mmp11 UTSW 10 75927382 start gained probably benign
R6753:Mmp11 UTSW 10 75928374 missense probably damaging 1.00
R7027:Mmp11 UTSW 10 75932396 unclassified probably benign
R7146:Mmp11 UTSW 10 75928446 missense probably benign
R7163:Mmp11 UTSW 10 75926576 missense possibly damaging 0.64
R7797:Mmp11 UTSW 10 75923480 missense
Predicted Primers PCR Primer
(F):5'- AGCTGGGCCATATGAAGTTG -3'
(R):5'- GAGCAGATCCACAGTGACTG -3'

Sequencing Primer
(F):5'- GCCATATGAAGTTGGGGGTC -3'
(R):5'- CAGTGGTGACTTGGCAGCTC -3'
Posted On2014-11-11