Incidental Mutation 'R6753:Mmp11'
ID530906
Institutional Source Beutler Lab
Gene Symbol Mmp11
Ensembl Gene ENSMUSG00000000901
Gene Namematrix metallopeptidase 11
SynonymsST3, stromelysin 3, Stmy3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6753 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75923222-75936496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75928374 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 86 (V86M)
Ref Sequence ENSEMBL: ENSMUSP00000112940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000924] [ENSMUST00000120281] [ENSMUST00000132869] [ENSMUST00000219728] [ENSMUST00000219839]
Predicted Effect probably damaging
Transcript: ENSMUST00000000924
AA Change: V86M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000924
Gene: ENSMUSG00000000901
AA Change: V86M

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120281
AA Change: V86M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112940
Gene: ENSMUSG00000000901
AA Change: V86M

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133897
Predicted Effect probably benign
Transcript: ENSMUST00000152222
SMART Domains Protein: ENSMUSP00000116279
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
Blast:HX 2 26 1e-8 BLAST
HX 29 76 7.63e-11 SMART
HX 78 117 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219728
Predicted Effect probably benign
Transcript: ENSMUST00000219839
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of endopeptidases that are involved in remodeling extracellular matrix during, for example, embryonic development and tumor progression. The encoded protein undergoes post-translational proteolytic processing by furin endopeptidase to form an active enzyme. Subcutaneous introduction of cells expressing the encoded protein into nude mice results in increased tumor incidence. Mice lacking the encoded protein exhibit a decreased incidence of chemically-induced tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice exhibit a decreased incidence of DMBA-induced carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Comt T C 16: 18,408,021 K205R probably benign Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Mmp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Mmp11 APN 10 75926821 missense probably benign 0.00
IGL01690:Mmp11 APN 10 75926896 missense probably damaging 1.00
IGL01804:Mmp11 APN 10 75928470 missense probably benign
R0285:Mmp11 UTSW 10 75925668 missense probably damaging 1.00
R0491:Mmp11 UTSW 10 75926758 missense probably benign 0.04
R0541:Mmp11 UTSW 10 75926933 missense probably damaging 1.00
R1857:Mmp11 UTSW 10 75928357 missense probably benign 0.01
R2400:Mmp11 UTSW 10 75925510 missense probably benign 0.18
R2442:Mmp11 UTSW 10 75927245 missense probably benign 0.09
R3157:Mmp11 UTSW 10 75927114 unclassified probably benign
R3158:Mmp11 UTSW 10 75927114 unclassified probably benign
R3159:Mmp11 UTSW 10 75927114 unclassified probably benign
R4915:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R4917:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R5137:Mmp11 UTSW 10 75925456 missense probably damaging 1.00
R5848:Mmp11 UTSW 10 75927389 missense probably damaging 1.00
R6156:Mmp11 UTSW 10 75926491 missense probably damaging 1.00
R6313:Mmp11 UTSW 10 75923984 makesense probably null
R6569:Mmp11 UTSW 10 75927382 start gained probably benign
R7027:Mmp11 UTSW 10 75932396 unclassified probably benign
R7146:Mmp11 UTSW 10 75928446 missense probably benign
R7163:Mmp11 UTSW 10 75926576 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- AATTTGGTCTTGGGCATCTCAG -3'
(R):5'- CCCTGGGGATCTGAAATCTG -3'

Sequencing Primer
(F):5'- TCTCAGGATGAAGGTGTAAGGATAAC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2018-08-01