Incidental Mutation 'R2435:Fshr'
ID249565
Institutional Source Beutler Lab
Gene Symbol Fshr
Ensembl Gene ENSMUSG00000032937
Gene Namefollicle stimulating hormone receptor
SynonymsFSH-R, Follitropin receptor, follicle-stimulating hormone receptor
MMRRC Submission 040396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2435 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location88985170-89200612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89200596 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 6 (V6D)
Ref Sequence ENSEMBL: ENSMUSP00000040477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035701]
Predicted Effect unknown
Transcript: ENSMUST00000035701
AA Change: V6D
SMART Domains Protein: ENSMUSP00000040477
Gene: ENSMUSG00000032937
AA Change: V6D

DomainStartEndE-ValueType
LRRNT 17 50 3.93e-3 SMART
Pfam:LRR_5 134 249 9e-7 PFAM
Pfam:GnHR_trans 282 348 4.6e-27 PFAM
Pfam:7tm_1 378 625 1.9e-30 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mutant females are sterile with small ovaries, blocked follicular development, atrophic uterus and imperforate vagina. Mutant males are fertile despite reduction in testis weight, oligozoospermia and reduced testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C T 19: 31,920,894 T226I probably benign Het
Acvr1 T C 2: 58,479,692 N102D probably damaging Het
Cd34 T A 1: 194,939,026 C21S probably damaging Het
Cdh18 C T 15: 23,367,008 R267W probably damaging Het
Ckap5 T A 2: 91,581,145 N966K probably benign Het
Clec4e A G 6: 123,288,896 V44A probably damaging Het
Cubn T A 2: 13,318,272 N2828I probably damaging Het
Dnah10 G T 5: 124,762,865 probably null Het
Gcc2 A G 10: 58,294,780 D1398G probably damaging Het
Gm13119 A T 4: 144,362,903 I264F possibly damaging Het
Gpi1 G A 7: 34,205,829 A390V probably damaging Het
Gypa G T 8: 80,506,768 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Ifna13 T A 4: 88,644,129 Q86L probably damaging Het
Itgae T A 11: 73,121,937 C698* probably null Het
Ivns1abp T C 1: 151,363,310 V625A probably benign Het
Kcnh2 A G 5: 24,326,347 probably null Het
Kcnj6 G A 16: 94,762,679 T320M probably damaging Het
Mblac2 T C 13: 81,750,249 I248T probably damaging Het
Muc5ac A T 7: 141,818,104 Y2647F possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr727 T C 14: 50,126,754 M59T probably damaging Het
Olfr815 G T 10: 129,902,304 N135K possibly damaging Het
Pard3b T A 1: 62,587,738 V1059E probably damaging Het
Pkd1l3 A C 8: 109,650,702 I1585L probably benign Het
Prrc2b A T 2: 32,219,729 S1791C probably damaging Het
Rbmxl2 C A 7: 107,210,331 S274R probably damaging Het
Serpini2 T C 3: 75,258,168 E168G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sis A G 3: 72,911,904 S1440P probably benign Het
Snrnp40 A G 4: 130,384,551 H283R probably damaging Het
Tcaf2 G T 6: 42,630,364 Q219K possibly damaging Het
Tenm3 C T 8: 48,287,953 R803H probably damaging Het
Ugt2b5 T C 5: 87,139,606 D234G probably damaging Het
Unc13d A G 11: 116,068,688 F653S probably damaging Het
Unc93b1 A G 19: 3,936,373 I136V possibly damaging Het
Utp20 A G 10: 88,820,891 S151P possibly damaging Het
Vmn2r50 C A 7: 10,053,099 W27L probably benign Het
Zan T C 5: 137,438,574 S2006G unknown Het
Other mutations in Fshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Fshr APN 17 88986191 missense probably damaging 1.00
IGL00272:Fshr APN 17 88985271 missense probably benign 0.00
IGL01067:Fshr APN 17 88985393 missense possibly damaging 0.95
IGL02093:Fshr APN 17 89001889 splice site probably null
IGL03184:Fshr APN 17 89046640 missense possibly damaging 0.80
IGL03383:Fshr APN 17 89046699 missense possibly damaging 0.69
IGL03383:Fshr APN 17 88985693 missense probably damaging 0.98
Absolut UTSW 17 88985342 missense possibly damaging 0.89
benedict UTSW 17 88985469 missense probably damaging 1.00
incremental UTSW 17 88985986 missense probably damaging 1.00
positively UTSW 17 88988607 missense probably damaging 1.00
R0056:Fshr UTSW 17 88988457 missense probably damaging 1.00
R0119:Fshr UTSW 17 89009285 missense probably benign 0.34
R0299:Fshr UTSW 17 89009285 missense probably benign 0.34
R0499:Fshr UTSW 17 89009285 missense probably benign 0.34
R0550:Fshr UTSW 17 89045125 missense probably benign 0.00
R1499:Fshr UTSW 17 88986101 missense probably damaging 1.00
R1656:Fshr UTSW 17 89200581 missense unknown
R3730:Fshr UTSW 17 89001715 missense probably benign 0.00
R3928:Fshr UTSW 17 88985534 missense probably damaging 1.00
R4065:Fshr UTSW 17 88985966 missense probably damaging 1.00
R4625:Fshr UTSW 17 88985720 missense probably damaging 1.00
R5062:Fshr UTSW 17 88986046 nonsense probably null
R5103:Fshr UTSW 17 89097368 missense possibly damaging 0.88
R5212:Fshr UTSW 17 88986256 missense probably benign 0.00
R5212:Fshr UTSW 17 88986257 missense probably benign 0.04
R5311:Fshr UTSW 17 89011013 critical splice donor site probably null
R5456:Fshr UTSW 17 88986348 missense probably benign
R5478:Fshr UTSW 17 89001715 missense probably benign 0.00
R5577:Fshr UTSW 17 88985923 missense probably benign 0.00
R5651:Fshr UTSW 17 88985829 missense possibly damaging 0.62
R5715:Fshr UTSW 17 88986396 critical splice acceptor site probably null
R5750:Fshr UTSW 17 88986241 missense probably benign 0.01
R5797:Fshr UTSW 17 89011075 missense probably damaging 1.00
R6041:Fshr UTSW 17 88985986 missense probably damaging 1.00
R6306:Fshr UTSW 17 89200533 missense probably null 0.00
R6589:Fshr UTSW 17 88988607 missense probably damaging 1.00
R6955:Fshr UTSW 17 88985466 missense probably benign 0.00
R7080:Fshr UTSW 17 89097111 splice site probably null
R7139:Fshr UTSW 17 88986161 missense possibly damaging 0.46
R7196:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7197:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7289:Fshr UTSW 17 88985844 missense probably benign 0.35
R7480:Fshr UTSW 17 88985374 nonsense probably null
R7562:Fshr UTSW 17 88988497 missense probably damaging 1.00
R7710:Fshr UTSW 17 88985255 missense probably benign 0.00
R7742:Fshr UTSW 17 88986162 missense probably benign
R7821:Fshr UTSW 17 88986213 missense probably damaging 0.99
R8043:Fshr UTSW 17 88986390 missense probably benign 0.06
R8251:Fshr UTSW 17 89200485 missense probably benign 0.02
R8475:Fshr UTSW 17 88986028 missense probably damaging 1.00
R8489:Fshr UTSW 17 88986367 missense probably benign 0.00
Z1176:Fshr UTSW 17 89046667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTCCAGCAGATATCAGTCTATTAG -3'
(R):5'- TTGCCTGGAAGCGACAAAAG -3'

Sequencing Primer
(F):5'- TAGTACTCAATGCTCAAATGGGAG -3'
(R):5'- CTTATCCGGACAGTGTGT -3'
Posted On2014-11-12