Incidental Mutation 'R2849:Aldh9a1'
ID251909
Institutional Source Beutler Lab
Gene Symbol Aldh9a1
Ensembl Gene ENSMUSG00000026687
Gene Namealdehyde dehydrogenase 9, subfamily A1
SynonymsESTM40, TMABA-DH
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location167349991-167368532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 167352628 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 97 (R97H)
Ref Sequence ENSEMBL: ENSMUSP00000028004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028004]
Predicted Effect probably damaging
Transcript: ENSMUST00000028004
AA Change: R97H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028004
Gene: ENSMUSG00000026687
AA Change: R97H

DomainStartEndE-ValueType
Pfam:Aldedh 46 507 1.5e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194843
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. It has a high activity for oxidation of gamma-aminobutyraldehyde and other amino aldehydes. The enzyme catalyzes the dehydrogenation of gamma-aminobutyraldehyde to gamma-aminobutyric acid (GABA). This isozyme is a tetramer of identical 54-kD subunits. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Aldh9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Aldh9a1 APN 1 167364574 missense probably benign 0.21
IGL01432:Aldh9a1 APN 1 167355785 missense probably damaging 1.00
IGL02370:Aldh9a1 APN 1 167356532 missense probably damaging 1.00
yummy UTSW 1 167352559 missense probably damaging 1.00
R0033:Aldh9a1 UTSW 1 167356571 missense probably damaging 0.99
R0197:Aldh9a1 UTSW 1 167361847 missense probably damaging 0.99
R0520:Aldh9a1 UTSW 1 167361391 splice site probably benign
R0836:Aldh9a1 UTSW 1 167350255 missense probably benign 0.03
R1224:Aldh9a1 UTSW 1 167352658 missense probably damaging 0.99
R1340:Aldh9a1 UTSW 1 167357344 missense probably benign 0.00
R1829:Aldh9a1 UTSW 1 167361854 missense probably benign 0.07
R4937:Aldh9a1 UTSW 1 167361807 missense probably damaging 0.96
R4965:Aldh9a1 UTSW 1 167365789 missense probably damaging 1.00
R5065:Aldh9a1 UTSW 1 167352559 missense probably damaging 1.00
R6578:Aldh9a1 UTSW 1 167355759 missense probably damaging 1.00
R7111:Aldh9a1 UTSW 1 167354452 missense probably benign 0.31
R7184:Aldh9a1 UTSW 1 167357396 missense probably benign 0.05
R7531:Aldh9a1 UTSW 1 167350326 missense probably benign
R7673:Aldh9a1 UTSW 1 167361550 missense probably benign 0.35
R8026:Aldh9a1 UTSW 1 167352667 critical splice donor site probably null
R8147:Aldh9a1 UTSW 1 167357380 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGTACTAAATGAGACCCTGGGAG -3'
(R):5'- TTTCACGTTCCAAGGTGGGC -3'

Sequencing Primer
(F):5'- CAGAGGATGCTGATAGAAACCTCTC -3'
(R):5'- TTCCAAGGTGGGCACGTG -3'
Posted On2014-12-04