Incidental Mutation 'R2852:Npsr1'
ID252320
Institutional Source Beutler Lab
Gene Symbol Npsr1
Ensembl Gene ENSMUSG00000043659
Gene Nameneuropeptide S receptor 1
SynonymsVRR1, PGR14, 9330128H10Rik, Gpr154
MMRRC Submission 040445-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2852 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24097996-24316398 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 24310005 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059650] [ENSMUST00000154644]
Predicted Effect probably benign
Transcript: ENSMUST00000059650
SMART Domains Protein: ENSMUSP00000056432
Gene: ENSMUSG00000043659

DomainStartEndE-ValueType
Pfam:7tm_1 66 330 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154337
Predicted Effect probably benign
Transcript: ENSMUST00000154644
SMART Domains Protein: ENSMUSP00000115126
Gene: ENSMUSG00000043659

DomainStartEndE-ValueType
Pfam:7tm_1 2 177 2.7e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased airway resistance when treated with high concentrations of U-46619. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Cblc A G 7: 19,780,964 probably null Het
Cfap54 T C 10: 92,940,155 Y48C probably damaging Het
Chrng A G 1: 87,206,706 I156M probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Ehbp1l1 T A 19: 5,716,487 D332V probably damaging Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Kap T C 6: 133,850,094 K92E probably benign Het
Kcnv2 T C 19: 27,323,096 Y116H probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Krtap13 T C 16: 88,751,636 probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mrln T C 10: 70,219,626 I44T possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Oosp3 T A 19: 11,699,532 probably null Het
Pah T A 10: 87,567,465 L131Q probably damaging Het
Pde6h G A 6: 136,963,208 C64Y probably damaging Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Prkdc T C 16: 15,652,552 probably null Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Stk11ip A G 1: 75,529,267 probably benign Het
Stx5a T C 19: 8,755,112 probably benign Het
Tek A G 4: 94,820,224 T340A probably benign Het
Tmeff1 T A 4: 48,604,692 probably null Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp14 A G 7: 30,039,171 Y130H probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Npsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Npsr1 APN 9 24254693 missense probably damaging 1.00
IGL02505:Npsr1 APN 9 24098282 missense probably benign
IGL03306:Npsr1 APN 9 24313239 missense probably benign 0.41
IGL03350:Npsr1 APN 9 24098309 missense probably benign
R0057:Npsr1 UTSW 9 24300427 missense probably damaging 1.00
R0385:Npsr1 UTSW 9 24313277 missense probably damaging 0.99
R1432:Npsr1 UTSW 9 24310075 missense probably damaging 1.00
R2033:Npsr1 UTSW 9 24313352 missense probably benign
R2323:Npsr1 UTSW 9 24300436 missense probably damaging 1.00
R2851:Npsr1 UTSW 9 24310005 splice site probably benign
R4088:Npsr1 UTSW 9 24313769 missense possibly damaging 0.56
R4757:Npsr1 UTSW 9 24134768 missense probably benign 0.00
R4812:Npsr1 UTSW 9 24289956 missense probably damaging 0.98
R5175:Npsr1 UTSW 9 24134815 missense probably benign 0.11
R5475:Npsr1 UTSW 9 24300419 missense probably damaging 1.00
R5568:Npsr1 UTSW 9 24313214 missense probably damaging 1.00
R5722:Npsr1 UTSW 9 24313800 missense probably damaging 1.00
R6778:Npsr1 UTSW 9 24254618 missense possibly damaging 0.96
R6811:Npsr1 UTSW 9 24134809 missense probably benign 0.03
R6931:Npsr1 UTSW 9 24289997 missense probably benign 0.27
R7356:Npsr1 UTSW 9 24098261 missense probably benign 0.29
R7569:Npsr1 UTSW 9 24313730 missense probably benign 0.00
R7908:Npsr1 UTSW 9 24289800 missense probably damaging 1.00
R7989:Npsr1 UTSW 9 24289800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATCTGGGCATTTGCATTG -3'
(R):5'- GCAGCAGTCAAACACACTGG -3'

Sequencing Primer
(F):5'- CATTGGGTTGCAAATTGAGCAGC -3'
(R):5'- CTGGTGAATCCAATACCATTCTTTG -3'
Posted On2014-12-04