Incidental Mutation 'R2929:Neurl2'
ID 254943
Institutional Source Beutler Lab
Gene Symbol Neurl2
Ensembl Gene ENSMUSG00000039873
Gene Name neuralized E3 ubiquitin protein ligase 2
Synonyms Ozz-E3, Ozz
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2929 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 164672652-164675376 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 164675264 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 33 (N33D)
Ref Sequence ENSEMBL: ENSMUSP00000041806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017904] [ENSMUST00000017911] [ENSMUST00000042775] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000127650] [ENSMUST00000151493] [ENSMUST00000143780] [ENSMUST00000152721]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000017904
SMART Domains Protein: ENSMUSP00000017904
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Peptidase_S10 52 489 2.5e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017911
SMART Domains Protein: ENSMUSP00000017911
Gene: ENSMUSG00000017767

DomainStartEndE-ValueType
Pfam:SPATA25 1 226 3.2e-144 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000042775
AA Change: N33D

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873
AA Change: N33D

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103092
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103093
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127650
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128596
Predicted Effect probably benign
Transcript: ENSMUST00000151493
Predicted Effect probably benign
Transcript: ENSMUST00000143780
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152721
SMART Domains Protein: ENSMUSP00000119814
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
Pfam:Peptidase_S10 45 227 1.7e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the regulation of myofibril organization. This protein is likely the adaptor component of the E3 ubiquitin ligase complex in striated muscle, and it regulates the ubiquitin-mediated degradation of beta-catenin during myogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display myofiber abnormalities in skeletal muscle and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd177 G A 7: 24,453,704 (GRCm39) Q396* probably null Het
Cdadc1 A T 14: 59,835,284 (GRCm39) M1K probably null Het
Cdc23 ACC AC 18: 34,770,371 (GRCm39) probably null Het
Cnnm3 T A 1: 36,563,140 (GRCm39) F701L possibly damaging Het
Cul7 C G 17: 46,962,526 (GRCm39) D52E probably benign Het
Dennd4a T C 9: 64,759,699 (GRCm39) V268A possibly damaging Het
Deup1 C T 9: 15,486,484 (GRCm39) V399I probably benign Het
Dscam T A 16: 96,486,612 (GRCm39) Q1021L possibly damaging Het
Dst A T 1: 34,206,143 (GRCm39) K932* probably null Het
Pnma8b T C 7: 16,680,617 (GRCm39) S534P possibly damaging Het
Pole2 G A 12: 69,256,712 (GRCm39) T271M probably benign Het
Ppfibp2 A G 7: 107,296,858 (GRCm39) M191V probably damaging Het
Rad51ap2 A G 12: 11,507,185 (GRCm39) Q369R probably benign Het
Rbm45 A G 2: 76,208,763 (GRCm39) I300V probably benign Het
Ro60 G A 1: 143,633,616 (GRCm39) A494V possibly damaging Het
Sco1 T A 11: 66,954,748 (GRCm39) I251K probably damaging Het
Spmip4 G A 6: 50,551,285 (GRCm39) T388I probably benign Het
Zfp202 T C 9: 40,122,984 (GRCm39) V582A possibly damaging Het
Zfp219 T A 14: 52,246,436 (GRCm39) E230D probably benign Het
Other mutations in Neurl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02274:Neurl2 APN 2 164,675,012 (GRCm39) missense probably damaging 1.00
R1458:Neurl2 UTSW 2 164,674,666 (GRCm39) missense possibly damaging 0.95
R3033:Neurl2 UTSW 2 164,674,975 (GRCm39) missense probably benign 0.02
R4849:Neurl2 UTSW 2 164,674,739 (GRCm39) splice site probably null
R4959:Neurl2 UTSW 2 164,675,122 (GRCm39) splice site probably null
R4973:Neurl2 UTSW 2 164,675,122 (GRCm39) splice site probably null
R5360:Neurl2 UTSW 2 164,675,021 (GRCm39) missense probably damaging 1.00
R5885:Neurl2 UTSW 2 164,674,811 (GRCm39) missense probably damaging 1.00
R8698:Neurl2 UTSW 2 164,675,054 (GRCm39) missense probably benign 0.10
R8701:Neurl2 UTSW 2 164,675,054 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGAAAACTCGGGTACAGCGG -3'
(R):5'- GGGAAATGCCTTACATGGTTC -3'

Sequencing Primer
(F):5'- TACAGCGGCCAGACTGG -3'
(R):5'- TGGTTCATCCACCCCGC -3'
Posted On 2014-12-29