Incidental Mutation 'R5360:Neurl2'
ID424271
Institutional Source Beutler Lab
Gene Symbol Neurl2
Ensembl Gene ENSMUSG00000039873
Gene Nameneuralized E3 ubiquitin protein ligase 2
SynonymsOzz, Ozz-E3
MMRRC Submission 042939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5360 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164830732-164833456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 164833101 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 114 (A114S)
Ref Sequence ENSEMBL: ENSMUSP00000041806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017911] [ENSMUST00000042775] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000127650] [ENSMUST00000143780] [ENSMUST00000151493] [ENSMUST00000152721]
Predicted Effect probably benign
Transcript: ENSMUST00000017911
SMART Domains Protein: ENSMUSP00000017911
Gene: ENSMUSG00000017767

DomainStartEndE-ValueType
Pfam:SPATA25 1 226 3.2e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042775
AA Change: A114S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873
AA Change: A114S

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103092
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103093
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127650
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143293
Predicted Effect probably benign
Transcript: ENSMUST00000143780
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147883
Predicted Effect probably benign
Transcript: ENSMUST00000151493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152721
SMART Domains Protein: ENSMUSP00000119814
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
Pfam:Peptidase_S10 45 227 1.7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155061
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the regulation of myofibril organization. This protein is likely the adaptor component of the E3 ubiquitin ligase complex in striated muscle, and it regulates the ubiquitin-mediated degradation of beta-catenin during myogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display myofiber abnormalities in skeletal muscle and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik G T 2: 148,783,378 L77F probably damaging Het
Acsl5 T A 19: 55,291,160 Y443* probably null Het
Aox3 C T 1: 58,146,508 T331M probably damaging Het
Arhgap32 G A 9: 32,259,671 R1598H probably damaging Het
Atp1a2 A G 1: 172,278,869 probably null Het
Brpf3 A T 17: 28,810,562 M499L probably benign Het
Cacnb1 A T 11: 98,018,271 probably null Het
Cep295 A G 9: 15,326,733 S1899P probably damaging Het
Cntn2 A G 1: 132,518,857 Y748H probably damaging Het
Csmd3 T A 15: 47,669,203 Y2532F probably damaging Het
D17Wsu92e A T 17: 27,794,046 I59N probably damaging Het
Dsg1a A G 18: 20,340,954 D1028G probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gabra5 C T 7: 57,490,785 G55R probably damaging Het
Gdf9 T A 11: 53,437,207 F330Y probably benign Het
Gimap8 T C 6: 48,656,302 S352P probably damaging Het
Gm4952 A T 19: 12,623,629 H71L probably benign Het
Gm6803 A C 12: 88,018,495 L93V probably benign Het
Gnaq G A 19: 16,133,426 R34H probably benign Het
Hebp2 T C 10: 18,544,307 D126G probably benign Het
Hectd4 A G 5: 121,315,401 D601G possibly damaging Het
Hook2 T C 8: 85,001,404 Y577H probably damaging Het
Igfals A G 17: 24,880,093 T53A probably benign Het
Igsf9b A G 9: 27,311,672 D123G probably damaging Het
Ikbkap A T 4: 56,800,104 H7Q probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mdm4 A T 1: 132,991,658 *490K probably null Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Nuggc A G 14: 65,638,626 T563A probably damaging Het
Olfr951 T G 9: 39,394,402 F204V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pdlim1 A T 19: 40,230,549 S213T probably damaging Het
Pitx1 T C 13: 55,828,478 I123V probably damaging Het
Pkd1l1 T C 11: 8,879,204 N1013D probably benign Het
Pla2g2c T A 4: 138,734,345 Y42N possibly damaging Het
Polr2b G A 5: 77,349,146 A1168T possibly damaging Het
Ppp2r2a G A 14: 67,016,571 R383* probably null Het
Prl7a2 C T 13: 27,659,160 R220H probably benign Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rc3h2 A G 2: 37,389,855 V454A possibly damaging Het
Robo1 A G 16: 72,935,777 T307A probably damaging Het
Slc22a6 T C 19: 8,619,422 L188P probably damaging Het
Spag17 A G 3: 100,109,410 N2167S probably benign Het
Spag5 G A 11: 78,314,762 E680K probably damaging Het
Spata6 A G 4: 111,822,829 Y428C possibly damaging Het
Tbc1d5 T C 17: 50,984,632 D47G probably benign Het
Trp53 T C 11: 69,588,740 probably null Het
Tsc22d1 TCAGCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCAGCA 14: 76,417,267 probably benign Het
Ttc39b T C 4: 83,261,847 D103G probably damaging Het
Ttn A C 2: 76,919,978 W3576G probably benign Het
Yeats2 T A 16: 20,154,162 M22K probably damaging Het
Other mutations in Neurl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02274:Neurl2 APN 2 164833092 missense probably damaging 1.00
R1458:Neurl2 UTSW 2 164832746 missense possibly damaging 0.95
R2929:Neurl2 UTSW 2 164833344 missense possibly damaging 0.95
R3033:Neurl2 UTSW 2 164833055 missense probably benign 0.02
R4849:Neurl2 UTSW 2 164832819 unclassified probably null
R4959:Neurl2 UTSW 2 164833202 splice site probably null
R4973:Neurl2 UTSW 2 164833202 splice site probably null
R5885:Neurl2 UTSW 2 164832891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGATCTAAGAGGTGGC -3'
(R):5'- AGTGCATGGAGCCAACATC -3'

Sequencing Primer
(F):5'- GCTATAAAGCCCTGGCCG -3'
(R):5'- ACACGCGTGGAGAGTTTC -3'
Posted On2016-08-04