Incidental Mutation 'R5885:Neurl2'
ID 456024
Institutional Source Beutler Lab
Gene Symbol Neurl2
Ensembl Gene ENSMUSG00000039873
Gene Name neuralized E3 ubiquitin protein ligase 2
Synonyms Ozz, Ozz-E3
MMRRC Submission 043237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5885 (G1)
Quality Score 216
Status Not validated
Chromosome 2
Chromosomal Location 164830732-164833456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 164832891 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 184 (T184A)
Ref Sequence ENSEMBL: ENSMUSP00000041806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017911] [ENSMUST00000042775] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000127650] [ENSMUST00000143780] [ENSMUST00000151493] [ENSMUST00000152721]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000017911
SMART Domains Protein: ENSMUSP00000017911
Gene: ENSMUSG00000017767

DomainStartEndE-ValueType
Pfam:SPATA25 1 226 3.2e-144 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042775
AA Change: T184A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873
AA Change: T184A

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103092
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103093
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127650
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143293
Predicted Effect probably benign
Transcript: ENSMUST00000143780
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147883
Predicted Effect probably benign
Transcript: ENSMUST00000151493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152721
SMART Domains Protein: ENSMUSP00000119814
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
Pfam:Peptidase_S10 45 227 1.7e-77 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the regulation of myofibril organization. This protein is likely the adaptor component of the E3 ubiquitin ligase complex in striated muscle, and it regulates the ubiquitin-mediated degradation of beta-catenin during myogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display myofiber abnormalities in skeletal muscle and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A T 13: 19,729,349 noncoding transcript Het
Acot10 T A 15: 20,666,104 M184L probably benign Het
Adgrv1 A T 13: 81,424,271 S4924T probably benign Het
Atp10a T A 7: 58,813,800 M1027K possibly damaging Het
Axl T A 7: 25,766,852 K510I probably damaging Het
Azi2 T A 9: 118,047,560 I48N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Dnah3 T C 7: 120,069,704 I720V probably benign Het
Dnah8 C T 17: 30,794,717 P3811S probably damaging Het
Epas1 A G 17: 86,827,544 D535G probably damaging Het
Fam47e A G 5: 92,565,968 K152R probably damaging Het
Fbxl3 A T 14: 103,083,231 I260K probably benign Het
Fcgr3 A G 1: 171,057,711 V115A probably damaging Het
Fgf12 G T 16: 28,398,294 D98E possibly damaging Het
Flt3 T C 5: 147,349,629 T716A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Grin2a A G 16: 9,761,905 Y165H possibly damaging Het
Ifna4 T A 4: 88,842,362 W168R probably damaging Het
Itga11 A G 9: 62,762,850 Y752C probably damaging Het
Khdrbs3 A G 15: 69,024,698 probably null Het
Kif24 A T 4: 41,423,463 Y263N probably damaging Het
Lama5 G T 2: 180,201,831 T441K probably damaging Het
Lrrc47 T A 4: 154,015,972 V335D possibly damaging Het
Map1b A T 13: 99,430,081 I2044N unknown Het
Mast2 C T 4: 116,314,838 G638S probably damaging Het
Myo9a T C 9: 59,871,220 S1420P probably benign Het
Nfatc3 A G 8: 106,096,312 I577V probably benign Het
Nipal3 A T 4: 135,471,977 V186E probably damaging Het
Pgbd5 G A 8: 124,384,466 T162M probably damaging Het
Plod2 T A 9: 92,606,656 probably null Het
Psg22 T A 7: 18,718,332 L19Q probably damaging Het
Psg27 T A 7: 18,561,786 N245Y probably damaging Het
Ptprc T A 1: 138,088,508 I539F probably damaging Het
Rad1 T C 15: 10,488,057 L59P probably damaging Het
Slc2a9 G A 5: 38,440,674 R137W probably damaging Het
Spats2l C T 1: 57,946,162 A458V probably damaging Het
Sptbn5 A G 2: 120,076,663 probably benign Het
Stox1 C A 10: 62,664,848 L644F probably damaging Het
Sv2b C T 7: 75,156,753 G213E probably damaging Het
Tas2r121 T G 6: 132,700,291 L239F probably damaging Het
Trrap T A 5: 144,794,793 V854E probably damaging Het
Vmn2r97 A G 17: 18,947,773 Y763C possibly damaging Het
Xkr6 T A 14: 63,606,911 W128R probably damaging Het
Other mutations in Neurl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02274:Neurl2 APN 2 164833092 missense probably damaging 1.00
R1458:Neurl2 UTSW 2 164832746 missense possibly damaging 0.95
R2929:Neurl2 UTSW 2 164833344 missense possibly damaging 0.95
R3033:Neurl2 UTSW 2 164833055 missense probably benign 0.02
R4849:Neurl2 UTSW 2 164832819 splice site probably null
R4959:Neurl2 UTSW 2 164833202 splice site probably null
R4973:Neurl2 UTSW 2 164833202 splice site probably null
R5360:Neurl2 UTSW 2 164833101 missense probably damaging 1.00
R8698:Neurl2 UTSW 2 164833134 missense probably benign 0.10
R8701:Neurl2 UTSW 2 164833134 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATACTCCAGCTGGACCAGAC -3'
(R):5'- TTGGGTCTTCGCTATCACAC -3'

Sequencing Primer
(F):5'- AGACGCACGCTCTTGGTG -3'
(R):5'- CCCGGGAAGGTCAACCAG -3'
Posted On 2017-02-15