Incidental Mutation 'R3011:Tmtc3'
ID257512
Institutional Source Beutler Lab
Gene Symbol Tmtc3
Ensembl Gene ENSMUSG00000036676
Gene Nametransmembrane and tetratricopeptide repeat containing 3
SynonymsB130008E12Rik, mSmile, 9130014E20Rik
MMRRC Submission 040533-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R3011 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location100443902-100487350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100447582 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 704 (P704T)
Ref Sequence ENSEMBL: ENSMUSP00000061470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058154] [ENSMUST00000099318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058154
AA Change: P704T

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000061470
Gene: ENSMUSG00000036676
AA Change: P704T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 263 336 5.4e-35 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
TPR 673 706 1.35e-1 SMART
TPR 707 740 1.44e1 SMART
TPR 741 775 1.51e1 SMART
TPR 776 809 9e1 SMART
low complexity region 867 880 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099318
SMART Domains Protein: ENSMUSP00000096921
Gene: ENSMUSG00000036676

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 261 338 2.6e-33 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the transmembrane and tetratricopeptide repeat-containing protein family. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired bronchial smooth muscle and alveolar myofibroblast development that leads to cyanosis and postnatal lethality in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432K21Rik C A 8: 84,166,910 Y235* probably null Het
Arhgap31 A C 16: 38,601,907 C1266G possibly damaging Het
Cers5 A G 15: 99,772,717 probably benign Het
Clasp2 C T 9: 113,901,513 T905M probably damaging Het
Clec16a A G 16: 10,611,111 N469S probably benign Het
Commd3 T A 2: 18,674,688 V128D probably damaging Het
Cped1 A G 6: 22,088,696 T253A probably damaging Het
Dnajc5b A T 3: 19,546,802 Y21F probably damaging Het
Fam160b1 T A 19: 57,385,288 L660Q probably damaging Het
Gm14403 A G 2: 177,508,993 D244G probably benign Het
Gm5414 T C 15: 101,625,612 D312G probably damaging Het
Gm884 T A 11: 103,613,103 T504S possibly damaging Het
Ifi204 T C 1: 173,751,651 S543G probably benign Het
Itga11 T A 9: 62,696,980 I50N probably damaging Het
Lct C T 1: 128,301,372 V795I possibly damaging Het
Map2 A G 1: 66,414,612 D887G probably damaging Het
Mgat4e T A 1: 134,542,108 D66V possibly damaging Het
Nqo1 C T 8: 107,389,111 R178H probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr70 G T 4: 43,696,624 A183E probably damaging Het
Otof G A 5: 30,382,840 A999V probably damaging Het
Phf20 A G 2: 156,288,026 D506G probably benign Het
Pth2r C T 1: 65,336,988 H97Y probably benign Het
Snx18 G A 13: 113,616,886 Q504* probably null Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Srgap2 T A 1: 131,310,591 Q520L probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tlr4 A T 4: 66,839,254 K95* probably null Het
Tmem59l A T 8: 70,486,237 C96S probably damaging Het
Upp2 T C 2: 58,790,095 V293A probably damaging Het
Vps72 A G 3: 95,119,274 K177E probably damaging Het
Other mutations in Tmtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tmtc3 APN 10 100471480 missense probably benign
IGL00962:Tmtc3 APN 10 100471953 missense probably damaging 1.00
IGL01670:Tmtc3 APN 10 100447125 missense probably benign 0.02
IGL01729:Tmtc3 APN 10 100447155 missense probably benign
IGL01933:Tmtc3 APN 10 100447605 missense probably benign 0.00
IGL01961:Tmtc3 APN 10 100447031 missense probably benign
IGL03063:Tmtc3 APN 10 100447606 missense probably benign 0.00
IGL03176:Tmtc3 APN 10 100466131 missense possibly damaging 0.57
IGL03195:Tmtc3 APN 10 100459034 missense probably benign 0.00
IGL03238:Tmtc3 APN 10 100477840 missense probably damaging 1.00
IGL03272:Tmtc3 APN 10 100457080 missense probably benign 0.00
IGL03335:Tmtc3 APN 10 100466254 missense probably damaging 0.97
IGL03375:Tmtc3 APN 10 100447719 missense possibly damaging 0.67
IGL03409:Tmtc3 APN 10 100451432 missense possibly damaging 0.75
deadloss UTSW 10 100450352 nonsense probably null
R0078:Tmtc3 UTSW 10 100448961 missense probably damaging 1.00
R0121:Tmtc3 UTSW 10 100458908 splice site probably benign
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0480:Tmtc3 UTSW 10 100471404 missense probably damaging 1.00
R1136:Tmtc3 UTSW 10 100472043 unclassified probably benign
R1203:Tmtc3 UTSW 10 100476744 missense probably damaging 1.00
R1253:Tmtc3 UTSW 10 100451390 missense probably benign 0.05
R2181:Tmtc3 UTSW 10 100448973 missense probably benign 0.00
R3430:Tmtc3 UTSW 10 100447575 missense probably benign 0.29
R3910:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3911:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3912:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R4773:Tmtc3 UTSW 10 100457139 missense possibly damaging 0.66
R4838:Tmtc3 UTSW 10 100466220 missense probably damaging 1.00
R4996:Tmtc3 UTSW 10 100447224 missense probably damaging 0.99
R5131:Tmtc3 UTSW 10 100448979 missense probably damaging 1.00
R5976:Tmtc3 UTSW 10 100476672 missense probably benign 0.00
R6700:Tmtc3 UTSW 10 100471477 missense probably benign 0.00
R7187:Tmtc3 UTSW 10 100477912 missense probably damaging 1.00
R7211:Tmtc3 UTSW 10 100447605 missense probably benign 0.05
R7299:Tmtc3 UTSW 10 100447474 missense not run
R7301:Tmtc3 UTSW 10 100447474 missense not run
R7329:Tmtc3 UTSW 10 100447419 missense probably benign 0.00
R7509:Tmtc3 UTSW 10 100466094 missense probably damaging 1.00
R7614:Tmtc3 UTSW 10 100450352 nonsense probably null
R8329:Tmtc3 UTSW 10 100447434 missense probably damaging 0.99
R8394:Tmtc3 UTSW 10 100446946 missense probably damaging 1.00
RF023:Tmtc3 UTSW 10 100477866 missense probably benign
Z1176:Tmtc3 UTSW 10 100471456 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGCTCCAGGTATATCCTTCTTTTGG -3'
(R):5'- GTACTGATCAAAGGTTTCAGTCAC -3'

Sequencing Primer
(F):5'- ATCCTTCTTTTGGTTCATCAGAATG -3'
(R):5'- GATCAAAGGTTTCAGTCACATTGTC -3'
Posted On2015-01-11