Incidental Mutation 'R4996:Tmtc3'
ID385271
Institutional Source Beutler Lab
Gene Symbol Tmtc3
Ensembl Gene ENSMUSG00000036676
Gene Nametransmembrane and tetratricopeptide repeat containing 3
SynonymsB130008E12Rik, mSmile, 9130014E20Rik
MMRRC Submission 042590-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4996 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location100443902-100487350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100447224 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 823 (I823N)
Ref Sequence ENSEMBL: ENSMUSP00000061470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058154] [ENSMUST00000099318]
Predicted Effect probably damaging
Transcript: ENSMUST00000058154
AA Change: I823N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061470
Gene: ENSMUSG00000036676
AA Change: I823N

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 263 336 5.4e-35 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
TPR 673 706 1.35e-1 SMART
TPR 707 740 1.44e1 SMART
TPR 741 775 1.51e1 SMART
TPR 776 809 9e1 SMART
low complexity region 867 880 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099318
SMART Domains Protein: ENSMUSP00000096921
Gene: ENSMUSG00000036676

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 173 192 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
transmembrane domain 237 259 N/A INTRINSIC
Pfam:DUF1736 261 338 2.6e-33 PFAM
transmembrane domain 353 375 N/A INTRINSIC
transmembrane domain 382 399 N/A INTRINSIC
TPR 451 484 8.23e-6 SMART
TPR 485 518 2.13e1 SMART
TPR 533 567 8.77e1 SMART
TPR 568 601 3.19e-3 SMART
TPR 602 635 1.06e-8 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the transmembrane and tetratricopeptide repeat-containing protein family. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired bronchial smooth muscle and alveolar myofibroblast development that leads to cyanosis and postnatal lethality in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actl11 A G 9: 107,931,735 I1086V possibly damaging Het
Adgrv1 T C 13: 81,578,734 S500G probably benign Het
Ahcyl1 A T 3: 107,668,287 V394E probably damaging Het
Alg9 T C 9: 50,808,705 F494L probably damaging Het
Ankrd55 C A 13: 112,356,088 D264E possibly damaging Het
Asb14 A G 14: 26,912,116 N426S possibly damaging Het
Atm A T 9: 53,524,507 F168I probably benign Het
Atp13a4 A T 16: 29,472,004 I209N probably damaging Het
BB014433 A T 8: 15,042,166 L229Q probably benign Het
C130026I21Rik G T 1: 85,247,094 A240E probably benign Het
Calml3 T C 13: 3,804,142 D21G probably damaging Het
Capn10 A G 1: 92,945,136 N528S probably damaging Het
Ccnl2 T A 4: 155,813,524 D141E possibly damaging Het
Cd163 A G 6: 124,319,147 I817V probably benign Het
Cgnl1 CTTGCCCAGGTT CTT 9: 71,724,826 probably benign Het
Cln6 T A 9: 62,850,655 I232N probably damaging Het
Col22a1 A C 15: 72,007,161 V49G probably damaging Het
Csmd1 A T 8: 15,910,452 M3321K probably damaging Het
Cyp2u1 T A 3: 131,298,284 M196L probably benign Het
Dlec1 T G 9: 119,146,050 L1566R probably damaging Het
Dnajc3 A G 14: 118,972,427 T305A probably benign Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Efhd1 G T 1: 87,264,558 G37W possibly damaging Het
Exph5 G C 9: 53,375,610 E1330D possibly damaging Het
Fam207a A T 10: 77,515,533 W14R probably null Het
Fbln2 A T 6: 91,266,010 Y913F probably benign Het
Fmnl1 G A 11: 103,182,656 S167N possibly damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Gm960 T A 19: 4,626,084 K673N probably benign Het
Gmpr2 T C 14: 55,676,795 I169T probably damaging Het
Gria2 A G 3: 80,707,141 S531P probably damaging Het
Hace1 G A 10: 45,649,950 A296T probably benign Het
Hrasls G A 16: 29,217,704 W31* probably null Het
Inhbb A C 1: 119,420,818 L90R probably damaging Het
Insr C T 8: 3,192,665 R18Q probably null Het
Kdm6b G T 11: 69,405,731 P570Q probably damaging Het
Lama3 T C 18: 12,518,743 V1803A probably benign Het
Lpin3 T A 2: 160,905,287 L811Q probably damaging Het
Lrrc8e C T 8: 4,235,166 L464F probably damaging Het
Micall2 A G 5: 139,710,589 S729P probably benign Het
Naca C T 10: 128,042,429 probably benign Het
Nav1 A T 1: 135,465,971 S1010T probably damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nlrp9c A T 7: 26,385,747 F136I possibly damaging Het
Nup210 A T 6: 91,053,436 F137Y probably benign Het
Olfr1079 T C 2: 86,538,271 I215V probably benign Het
Olfr402 A G 11: 74,155,331 H59R probably damaging Het
Olfr98 A G 17: 37,262,867 S266P probably benign Het
Otog C A 7: 46,298,606 H2344N possibly damaging Het
Otog C A 7: 46,305,510 C517* probably null Het
Pcdhac1 C T 18: 37,092,527 Q798* probably null Het
Pdhx T C 2: 103,030,312 D330G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pgr C A 9: 8,900,913 P149Q probably damaging Het
Ppm1h A T 10: 122,941,340 I504F probably damaging Het
Ppp6r3 A G 19: 3,473,833 S556P probably damaging Het
Ranbp9 G A 13: 43,425,094 Q168* probably null Het
Relb A T 7: 19,615,603 L259Q probably benign Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rgcc T C 14: 79,290,276 D125G possibly damaging Het
Rmnd5b A G 11: 51,627,908 V86A probably damaging Het
Slc15a5 G A 6: 138,043,585 T250M probably damaging Het
Slc7a2 A T 8: 40,912,562 K477* probably null Het
Smc2 T A 4: 52,461,042 probably null Het
Sox5 A T 6: 144,028,344 L226* probably null Het
Syne2 A G 12: 75,943,950 E1903G possibly damaging Het
Tenm3 A T 8: 48,235,826 I2226N probably damaging Het
Tor3a T C 1: 156,655,772 Y360C probably damaging Het
Trpc3 T C 3: 36,662,818 E357G probably benign Het
Ttc30a1 C T 2: 75,979,922 G606S probably benign Het
Tubgcp6 A T 15: 89,103,490 N1093K possibly damaging Het
Vmn1r64 T A 7: 5,884,053 T164S probably benign Het
Vmn2r40 T A 7: 8,908,167 Q709L probably damaging Het
Vmn2r81 A T 10: 79,293,413 I713L probably benign Het
Washc5 T C 15: 59,333,635 T686A probably benign Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Other mutations in Tmtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tmtc3 APN 10 100471480 missense probably benign
IGL00962:Tmtc3 APN 10 100471953 missense probably damaging 1.00
IGL01670:Tmtc3 APN 10 100447125 missense probably benign 0.02
IGL01729:Tmtc3 APN 10 100447155 missense probably benign
IGL01933:Tmtc3 APN 10 100447605 missense probably benign 0.00
IGL01961:Tmtc3 APN 10 100447031 missense probably benign
IGL03063:Tmtc3 APN 10 100447606 missense probably benign 0.00
IGL03176:Tmtc3 APN 10 100466131 missense possibly damaging 0.57
IGL03195:Tmtc3 APN 10 100459034 missense probably benign 0.00
IGL03238:Tmtc3 APN 10 100477840 missense probably damaging 1.00
IGL03272:Tmtc3 APN 10 100457080 missense probably benign 0.00
IGL03335:Tmtc3 APN 10 100466254 missense probably damaging 0.97
IGL03375:Tmtc3 APN 10 100447719 missense possibly damaging 0.67
IGL03409:Tmtc3 APN 10 100451432 missense possibly damaging 0.75
R0078:Tmtc3 UTSW 10 100448961 missense probably damaging 1.00
R0121:Tmtc3 UTSW 10 100458908 splice site probably benign
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0234:Tmtc3 UTSW 10 100450322 missense probably benign 0.44
R0480:Tmtc3 UTSW 10 100471404 missense probably damaging 1.00
R1136:Tmtc3 UTSW 10 100472043 unclassified probably benign
R1203:Tmtc3 UTSW 10 100476744 missense probably damaging 1.00
R1253:Tmtc3 UTSW 10 100451390 missense probably benign 0.05
R2181:Tmtc3 UTSW 10 100448973 missense probably benign 0.00
R3011:Tmtc3 UTSW 10 100447582 missense possibly damaging 0.76
R3430:Tmtc3 UTSW 10 100447575 missense probably benign 0.29
R3910:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3911:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R3912:Tmtc3 UTSW 10 100449026 missense probably damaging 1.00
R4773:Tmtc3 UTSW 10 100457139 missense possibly damaging 0.66
R4838:Tmtc3 UTSW 10 100466220 missense probably damaging 1.00
R5131:Tmtc3 UTSW 10 100448979 missense probably damaging 1.00
R5976:Tmtc3 UTSW 10 100476672 missense probably benign 0.00
R6700:Tmtc3 UTSW 10 100471477 missense probably benign 0.00
R7187:Tmtc3 UTSW 10 100477912 missense probably damaging 1.00
R7211:Tmtc3 UTSW 10 100447605 missense probably benign 0.05
R7299:Tmtc3 UTSW 10 100447474 missense not run
R7301:Tmtc3 UTSW 10 100447474 missense not run
R7329:Tmtc3 UTSW 10 100447419 missense probably benign 0.00
R7509:Tmtc3 UTSW 10 100466094 missense probably damaging 1.00
R7614:Tmtc3 UTSW 10 100450352 nonsense probably null
RF023:Tmtc3 UTSW 10 100477866 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGCCTTTTCAAAGCAGCAAC -3'
(R):5'- ACTATCCTGACCATACCAAGGG -3'

Sequencing Primer
(F):5'- TCAAAGCAGCAACTCTTTTCTTC -3'
(R):5'- CCAAGGGTCTCATTTTAAAAGGAG -3'
Posted On2016-05-10