Incidental Mutation 'R3704:Fbxl7'
ID258674
Institutional Source Beutler Lab
Gene Symbol Fbxl7
Ensembl Gene ENSMUSG00000043556
Gene NameF-box and leucine-rich repeat protein 7
SynonymsD230018M15Rik, Fbl6, FBL7
MMRRC Submission 040697-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3704 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location26540459-26895580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26543755 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 269 (G269C)
Ref Sequence ENSEMBL: ENSMUSP00000061305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059204]
Predicted Effect probably damaging
Transcript: ENSMUST00000059204
AA Change: G269C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061305
Gene: ENSMUSG00000043556
AA Change: G269C

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 73 79 N/A INTRINSIC
FBOX 117 157 2.7e-11 SMART
LRR_CC 185 210 2e-7 SMART
LRR_CC 211 236 2.1e-7 SMART
LRR 237 262 6.3e-7 SMART
LRR 271 296 3.5e-1 SMART
LRR_CC 297 322 1.7e-8 SMART
LRR_CC 323 348 5.5e-8 SMART
LRR_CC 349 374 6.5e-8 SMART
LRR_CC 375 400 9.1e-10 SMART
LRR_CC 401 426 2.1e-8 SMART
LRR_CC 427 452 1.8e-7 SMART
Blast:LRR 453 477 2e-7 BLAST
Meta Mutation Damage Score 0.3308 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 91.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by a 42-48 amino acid motif, the F-box, which binds to the S-phase kinase-associated protein 1 (Skp1) protein. The F-box proteins constitute one of the four subunits of E3 ubiquitin protein ligases called SCFs (SKP1-Cul1-F-box), which play a role in phosphorylation-dependent ubiquitination of proteins. The F-box proteins are divided into 3 subfamilies based on the other domain in the protein: F-box proteins that also have a WD-40 domain (Fbws subfamily), F-box proteins that also have leucine-rich repeats (Fbls subfamily) and F-box proteins that contain other motifs or lack known protein-interaction domains (Fbxs subfamily). The protein encoded by this gene belongs to the Fbls subfamily. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 T C 11: 48,947,976 T595A possibly damaging Het
Akap13 T C 7: 75,666,550 C585R probably damaging Het
Akr1b10 G T 6: 34,394,754 D285Y probably damaging Het
Akr1b10 A G 6: 34,394,755 D257G probably benign Het
Ankrd17 A T 5: 90,243,969 N1838K possibly damaging Het
Asap3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA 4: 136,241,241 probably benign Het
Bcap29 T C 12: 31,617,152 H170R probably benign Het
Brwd3 A G X: 108,760,415 probably benign Het
Capn1 T C 19: 6,007,371 E349G probably damaging Het
Cd27 C T 6: 125,233,398 C222Y probably damaging Het
Cdh12 C A 15: 21,583,826 T584K probably damaging Het
Col13a1 A G 10: 61,867,829 probably null Het
Col22a1 T C 15: 71,970,307 T443A probably damaging Het
Crisp3 A G 17: 40,235,957 probably benign Het
Cubn T A 2: 13,350,943 H1826L probably damaging Het
Eci2 A G 13: 34,993,233 probably benign Het
Fat2 A C 11: 55,309,650 F866C probably damaging Het
Hjurp G C 1: 88,277,215 probably benign Het
Ifi35 G A 11: 101,448,604 M1I probably null Het
Jarid2 A G 13: 44,902,355 T308A probably benign Het
Kcnq3 A G 15: 66,021,739 probably null Het
Kcnt2 C T 1: 140,533,968 T819M probably damaging Het
Kifc3 G A 8: 95,104,028 probably benign Het
Mill1 A G 7: 18,263,053 T190A possibly damaging Het
Mosmo A G 7: 120,730,605 I150V probably damaging Het
Nemf C A 12: 69,331,130 D566Y probably damaging Het
Nisch A G 14: 31,176,745 probably benign Het
Olfr888 T A 9: 38,109,003 F106I possibly damaging Het
Paip2 A G 18: 35,610,921 T9A probably benign Het
Pde5a T C 3: 122,779,019 S318P probably benign Het
Plcd1 T C 9: 119,076,209 I145V possibly damaging Het
Prl2c2 C T 13: 13,002,225 R37H probably damaging Het
Raet1e A G 10: 22,180,845 T107A probably benign Het
Reps1 T G 10: 18,107,680 F424V probably damaging Het
Skint6 A T 4: 113,136,472 V401D possibly damaging Het
Srgn T C 10: 62,497,830 D56G probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Ttn A T 2: 76,831,780 probably benign Het
Ugt2b37 A T 5: 87,242,987 F340L possibly damaging Het
Xirp1 T A 9: 120,016,907 Q970L probably benign Het
Zfr2 T G 10: 81,246,079 V493G probably benign Het
Zmat4 A G 8: 23,797,414 R59G probably benign Het
Other mutations in Fbxl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Fbxl7 APN 15 26789563 missense probably damaging 0.98
R0482:Fbxl7 UTSW 15 26543546 missense probably benign 0.06
R1734:Fbxl7 UTSW 15 26543649 missense probably damaging 1.00
R1826:Fbxl7 UTSW 15 26552765 missense possibly damaging 0.59
R1859:Fbxl7 UTSW 15 26543193 missense probably damaging 1.00
R2410:Fbxl7 UTSW 15 26895025 missense possibly damaging 0.79
R3703:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R4025:Fbxl7 UTSW 15 26552819 missense probably benign 0.20
R4387:Fbxl7 UTSW 15 26543259 missense probably damaging 1.00
R5055:Fbxl7 UTSW 15 26552936 missense probably damaging 0.98
R5070:Fbxl7 UTSW 15 26789554 missense probably benign 0.15
R5180:Fbxl7 UTSW 15 26543421 missense probably damaging 1.00
R5260:Fbxl7 UTSW 15 26543499 missense probably damaging 1.00
R5720:Fbxl7 UTSW 15 26552893 missense probably damaging 0.98
R6256:Fbxl7 UTSW 15 26553002 missense probably benign 0.16
R6874:Fbxl7 UTSW 15 26552942 missense probably benign
R7143:Fbxl7 UTSW 15 26543158 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGTCACTGACAAAGCGG -3'
(R):5'- CGGAAGTGTTAACCCCTGTG -3'

Sequencing Primer
(F):5'- TGACACTCAGCTCCTTGATGGAAG -3'
(R):5'- ACCCCTGTGTTTTAGCTAGAGAGAAG -3'
Posted On2015-01-23