Incidental Mutation 'R3177:Ano9'
ID259167
Institutional Source Beutler Lab
Gene Symbol Ano9
Ensembl Gene ENSMUSG00000054662
Gene Nameanoctamin 9
Synonyms5430425C04Rik, Tmem16j, Trp53i5, Tp53i5
MMRRC Submission 040615-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3177 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141101212-141117806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141104124 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 543 (T543S)
Ref Sequence ENSEMBL: ENSMUSP00000067689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067836] [ENSMUST00000097958] [ENSMUST00000209294] [ENSMUST00000210167]
Predicted Effect probably damaging
Transcript: ENSMUST00000067836
AA Change: T543S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: T543S

DomainStartEndE-ValueType
Pfam:Anoctamin 174 730 3.3e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097958
SMART Domains Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

DomainStartEndE-ValueType
IG 17 112 5.21e-2 SMART
transmembrane domain 117 139 N/A INTRINSIC
Pfam:TIR 163 327 2.2e-19 PFAM
Pfam:TIR_2 166 308 2.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157917
Predicted Effect probably benign
Transcript: ENSMUST00000209294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210085
Predicted Effect probably benign
Transcript: ENSMUST00000210167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211515
Meta Mutation Damage Score 0.1918 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 100% (21/21)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyb561 T C 11: 105,935,787 probably benign Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5581 C G 6: 131,166,965 noncoding transcript Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Hao2 T C 3: 98,880,328 probably benign Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Ano9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ano9 APN 7 141102042 nonsense probably null
IGL01620:Ano9 APN 7 141110439 missense probably damaging 1.00
IGL02045:Ano9 APN 7 141102469 missense probably benign 0.00
IGL02506:Ano9 APN 7 141102254 unclassified probably benign
IGL02657:Ano9 APN 7 141107440 missense probably damaging 1.00
IGL02731:Ano9 APN 7 141107204 missense probably damaging 1.00
IGL02863:Ano9 APN 7 141108651 missense probably benign 0.00
R0114:Ano9 UTSW 7 141103239 unclassified probably benign
R0374:Ano9 UTSW 7 141107814 missense probably damaging 0.98
R0487:Ano9 UTSW 7 141107849 missense possibly damaging 0.85
R0600:Ano9 UTSW 7 141104710 missense probably damaging 1.00
R0702:Ano9 UTSW 7 141107282 missense probably damaging 1.00
R0765:Ano9 UTSW 7 141107184 missense probably damaging 1.00
R1679:Ano9 UTSW 7 141108297 missense probably benign 0.03
R1773:Ano9 UTSW 7 141108378 missense possibly damaging 0.95
R1809:Ano9 UTSW 7 141108804 missense possibly damaging 0.93
R1883:Ano9 UTSW 7 141102331 missense probably benign
R2034:Ano9 UTSW 7 141108135 missense probably damaging 0.99
R2159:Ano9 UTSW 7 141108117 missense probably benign 0.01
R2254:Ano9 UTSW 7 141103090 missense probably benign
R2293:Ano9 UTSW 7 141102515 missense probably benign
R3277:Ano9 UTSW 7 141104124 missense probably damaging 1.00
R4274:Ano9 UTSW 7 141110695 missense probably benign
R4576:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4577:Ano9 UTSW 7 141104138 missense probably damaging 1.00
R4872:Ano9 UTSW 7 141107204 missense probably damaging 1.00
R4879:Ano9 UTSW 7 141110502 missense probably benign 0.23
R5160:Ano9 UTSW 7 141104365 missense probably damaging 1.00
R5560:Ano9 UTSW 7 141110482 missense probably damaging 1.00
R6148:Ano9 UTSW 7 141106785 missense probably damaging 1.00
R6302:Ano9 UTSW 7 141104308 missense probably damaging 1.00
R6821:Ano9 UTSW 7 141107256 missense possibly damaging 0.70
R7253:Ano9 UTSW 7 141107437 missense probably damaging 0.96
R7479:Ano9 UTSW 7 141102435 missense probably damaging 0.99
R7836:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R7919:Ano9 UTSW 7 141103201 missense probably damaging 1.00
R8051:Ano9 UTSW 7 141104532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTTCAACGTGGCCTGG -3'
(R):5'- GTGGCAGCGTAACTACTACATG -3'

Sequencing Primer
(F):5'- GAAGTTGCTCTTCCCAGCG -3'
(R):5'- TGGCAGCGTAACTACTACATGAATCC -3'
Posted On2015-01-23