Mutagenetix > Incidental Mutation

Incidental Mutation 'R3177:Ano9'

259167

Institutional Source

Beutler Lab

Gene Symbol

Ano9

Ensembl Gene

ENSMUSG00000054662

Gene Name

anoctamin 9

Synonyms

5430425C04Rik, Tmem16j, Trp53i5, Tp53i5

MMRRC Submission

040615-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R3177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141101212-141117806 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 141104124 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 543 (T543S)

Ref Sequence

ENSEMBL: ENSMUSP00000067689 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067836] [ENSMUST00000097958] [ENSMUST00000209294] [ENSMUST00000210167]

AlphaFold

P86044

Predicted Effect

probably damaging
Transcript: ENSMUST00000067836
AA Change: T543S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067689
Gene: ENSMUSG00000054662
AA Change: T543S

Domain	Start	End	E-Value	Type
Pfam:Anoctamin	174	730	3.3e-118	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097958

SMART Domains

Protein: ENSMUSP00000095571
Gene: ENSMUSG00000025494

Domain	Start	End	E-Value	Type
IG	17	112	5.21e-2	SMART
transmembrane domain	117	139	N/A	INTRINSIC
Pfam:TIR	163	327	2.2e-19	PFAM
Pfam:TIR_2	166	308	2.1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157917

Predicted Effect

probably benign
Transcript: ENSMUST00000209294

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210085

Predicted Effect

probably benign
Transcript: ENSMUST00000210167

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210496

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210763

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210927

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210978

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211515

Meta Mutation Damage Score

0.1918

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

100% (21/21)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TMEM16 (anoctamin) family of proteins, some of which form integral membrane calcium-activated chloride channels. The function of the encoded protein has yet to be elucidated, although it may have channel-forming abilities and also may have phospholipid scramblase activity. This gene has been observed to be upregulated in stage II and III colorectal cancers. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyb561	T	C	11: 105,935,787		probably benign	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5581	C	G	6: 131,166,965		noncoding transcript	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Hao2	T	C	3: 98,880,328		probably benign	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Ano9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ano9	APN	7	141102042	nonsense	probably null
IGL01620:Ano9	APN	7	141110439	missense	probably damaging	1.00
IGL02045:Ano9	APN	7	141102469	missense	probably benign	0.00
IGL02506:Ano9	APN	7	141102254	unclassified	probably benign
IGL02657:Ano9	APN	7	141107440	missense	probably damaging	1.00
IGL02731:Ano9	APN	7	141107204	missense	probably damaging	1.00
IGL02863:Ano9	APN	7	141108651	missense	probably benign	0.00
R0114:Ano9	UTSW	7	141103239	unclassified	probably benign
R0374:Ano9	UTSW	7	141107814	missense	probably damaging	0.98
R0487:Ano9	UTSW	7	141107849	missense	possibly damaging	0.85
R0600:Ano9	UTSW	7	141104710	missense	probably damaging	1.00
R0702:Ano9	UTSW	7	141107282	missense	probably damaging	1.00
R0765:Ano9	UTSW	7	141107184	missense	probably damaging	1.00
R1679:Ano9	UTSW	7	141108297	missense	probably benign	0.03
R1773:Ano9	UTSW	7	141108378	missense	possibly damaging	0.95
R1809:Ano9	UTSW	7	141108804	missense	possibly damaging	0.93
R1883:Ano9	UTSW	7	141102331	missense	probably benign
R2034:Ano9	UTSW	7	141108135	missense	probably damaging	0.99
R2159:Ano9	UTSW	7	141108117	missense	probably benign	0.01
R2254:Ano9	UTSW	7	141103090	missense	probably benign
R2293:Ano9	UTSW	7	141102515	missense	probably benign
R3277:Ano9	UTSW	7	141104124	missense	probably damaging	1.00
R4274:Ano9	UTSW	7	141110695	missense	probably benign
R4576:Ano9	UTSW	7	141104138	missense	probably damaging	1.00
R4577:Ano9	UTSW	7	141104138	missense	probably damaging	1.00
R4872:Ano9	UTSW	7	141107204	missense	probably damaging	1.00
R4879:Ano9	UTSW	7	141110502	missense	probably benign	0.23
R5160:Ano9	UTSW	7	141104365	missense	probably damaging	1.00
R5560:Ano9	UTSW	7	141110482	missense	probably damaging	1.00
R6148:Ano9	UTSW	7	141106785	missense	probably damaging	1.00
R6302:Ano9	UTSW	7	141104308	missense	probably damaging	1.00
R6821:Ano9	UTSW	7	141107256	missense	possibly damaging	0.70
R7253:Ano9	UTSW	7	141107437	missense	probably damaging	0.96
R7479:Ano9	UTSW	7	141102435	missense	probably damaging	0.99
R7836:Ano9	UTSW	7	141103201	missense	probably damaging	1.00
R7942:Ano9	UTSW	7	141104076	missense	probably damaging	0.96
R8051:Ano9	UTSW	7	141104532	missense	probably damaging	1.00
R8341:Ano9	UTSW	7	141102334	missense	possibly damaging	0.94
R8690:Ano9	UTSW	7	141104307	missense	probably benign	0.26
R9137:Ano9	UTSW	7	141104115	missense	probably damaging	1.00
R9355:Ano9	UTSW	7	141101904	missense	probably benign	0.00
R9521:Ano9	UTSW	7	141102314	missense	probably benign	0.01
R9645:Ano9	UTSW	7	141107475	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- ATTGCTTCAACGTGGCCTGG -3'
(R):5'- GTGGCAGCGTAACTACTACATG -3'

Sequencing Primer
(F):5'- GAAGTTGCTCTTCCCAGCG -3'
(R):5'- TGGCAGCGTAACTACTACATGAATCC -3'

Posted On

2015-01-23