Incidental Mutation 'R3712:Rrn3'
ID259688
Institutional Source Beutler Lab
Gene Symbol Rrn3
Ensembl Gene ENSMUSG00000022682
Gene NameRRN3 RNA polymerase I transcription factor homolog (yeast)
SynonymsTIF-1A, E130302O19Rik
MMRRC Submission 040705-MU
Accession Numbers

Genbank: NM_001039521; MGI: 1925255

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3712 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13780708-13814839 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 13784095 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 71 (L71*)
Ref Sequence ENSEMBL: ENSMUSP00000023363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023363]
Predicted Effect probably null
Transcript: ENSMUST00000023363
AA Change: L71*
SMART Domains Protein: ENSMUSP00000023363
Gene: ENSMUSG00000022682
AA Change: L71*

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:RRN3 46 584 7.5e-138 PFAM
low complexity region 597 605 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230102
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure to undergo embryonic turning, delayed embryonic development, markedly reduced embryo size, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(36)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik C A 16: 88,627,523 V27F unknown Het
Akr1c20 T C 13: 4,510,223 E152G probably damaging Het
Alx4 G A 2: 93,642,789 G44D possibly damaging Het
Arhgap31 T A 16: 38,602,533 E1057V possibly damaging Het
Arhgef26 A T 3: 62,423,629 D588V probably damaging Het
Bag2 T A 1: 33,746,916 E108D probably benign Het
Ccdc162 C T 10: 41,587,379 V183I probably benign Het
Ccdc58 T C 16: 36,081,405 probably null Het
Ccdc83 A G 7: 90,236,355 probably benign Het
Ccnyl1 G A 1: 64,714,668 E137K probably damaging Het
Celsr2 T C 3: 108,400,839 T1849A probably benign Het
Cep192 C A 18: 67,820,329 D472E probably benign Het
Cep57l1 A G 10: 41,743,114 Y86H probably damaging Het
Cep95 G T 11: 106,811,286 E370* probably null Het
Cldn10 A G 14: 118,855,110 T41A probably damaging Het
Clptm1l T A 13: 73,616,038 Y426N probably benign Het
Eps15 T C 4: 109,309,177 V89A probably damaging Het
Fam53b A G 7: 132,759,925 S125P probably damaging Het
Fam69b T C 2: 26,632,638 L33S possibly damaging Het
Fbxo44 A T 4: 148,156,004 W256R probably benign Het
Gnl2 T C 4: 125,046,274 V313A probably damaging Het
Hyal4 A G 6: 24,756,514 R244G probably damaging Het
Irf6 G T 1: 193,162,623 W134L probably benign Het
Kcnu1 A G 8: 25,881,420 T286A probably damaging Het
Lpcat2 T C 8: 92,918,170 V529A possibly damaging Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp8 G T 4: 107,848,302 R209L probably benign Het
Mgll T C 6: 88,764,588 probably benign Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr411 A T 11: 74,347,197 I129N probably damaging Het
Olfr490 A T 7: 108,286,456 Y223* probably null Het
Olfr776 A T 10: 129,261,224 K88* probably null Het
Orc1 T C 4: 108,604,021 V526A probably damaging Het
Pard3b T C 1: 62,343,978 S744P probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pdcd11 T A 19: 47,127,245 probably benign Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Pigt A G 2: 164,501,645 D347G probably benign Het
Rbm27 T C 18: 42,292,112 probably benign Het
Rpl7a-ps10 A G 9: 97,179,873 E232G probably damaging Het
Rprd2 A G 3: 95,764,560 L1177P probably damaging Het
Sbspon A G 1: 15,892,445 C70R probably damaging Het
Smtn A T 11: 3,532,865 probably null Het
Son A G 16: 91,656,726 D787G probably damaging Het
Sphkap C T 1: 83,277,112 S972N probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
Srp14 A C 2: 118,478,959 L58V probably null Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trdn T C 10: 33,157,166 I129T probably benign Het
Trpv3 A G 11: 73,278,954 K117R probably benign Het
Ubqlnl A T 7: 104,149,138 I384N probably benign Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r59 A T 7: 5,454,638 I41K probably damaging Het
Vmn2r125 T A 4: 156,350,124 Y68* probably null Het
Zpld1 A T 16: 55,226,436 L390* probably null Het
Other mutations in Rrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Rrn3 APN 16 13809062 missense probably damaging 1.00
IGL02507:Rrn3 APN 16 13788857 missense probably benign
IGL02607:Rrn3 APN 16 13806563 missense possibly damaging 0.65
IGL02648:Rrn3 APN 16 13811589 missense probably benign
IGL03217:Rrn3 APN 16 13809011 missense possibly damaging 0.83
IGL03403:Rrn3 APN 16 13799945 nonsense probably null
11287:Rrn3 UTSW 16 13800019 splice site probably null
ANU74:Rrn3 UTSW 16 13811533 missense possibly damaging 0.65
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0013:Rrn3 UTSW 16 13813113 missense possibly damaging 0.92
R0308:Rrn3 UTSW 16 13799882 splice site probably benign
R1970:Rrn3 UTSW 16 13789074 missense probably damaging 1.00
R3959:Rrn3 UTSW 16 13782100 critical splice donor site probably null
R4343:Rrn3 UTSW 16 13784122 missense probably benign 0.01
R4678:Rrn3 UTSW 16 13796076 missense probably damaging 1.00
R4920:Rrn3 UTSW 16 13790639 missense probably benign 0.01
R4925:Rrn3 UTSW 16 13799972 missense probably damaging 1.00
R5225:Rrn3 UTSW 16 13792934 splice site probably null
R5469:Rrn3 UTSW 16 13813100 missense probably benign 0.01
R5702:Rrn3 UTSW 16 13813266 nonsense probably null
R6059:Rrn3 UTSW 16 13806604 missense probably benign
R6425:Rrn3 UTSW 16 13811601 missense probably benign 0.00
R7582:Rrn3 UTSW 16 13810511 nonsense probably null
R7814:Rrn3 UTSW 16 13811589 missense probably benign
Z1176:Rrn3 UTSW 16 13813156 missense probably damaging 1.00
Z1177:Rrn3 UTSW 16 13788846 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCCTGCCTTAAATATGAATTTGT -3'
(R):5'- CACATGGGTGTTAAAAGTGAGTTAT -3'

Sequencing Primer
(F):5'- GTAGACGTTTCATGGTTCCT -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2015-01-23