Incidental Mutation 'R2897:Vps41'
ID260869
Institutional Source Beutler Lab
Gene Symbol Vps41
Ensembl Gene ENSMUSG00000041236
Gene NameVPS41 HOPS complex subunit
SynonymsVam2, mVam2
MMRRC Submission 040485-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2897 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location18717286-18866811 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 18810428 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072961]
Predicted Effect probably benign
Transcript: ENSMUST00000072961
SMART Domains Protein: ENSMUSP00000072729
Gene: ENSMUSG00000041236

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Blast:WD40 34 70 2e-7 BLAST
SCOP:d1flga_ 44 253 6e-9 SMART
Blast:WD40 159 195 3e-11 BLAST
CLH 570 711 1.92e-42 SMART
RING 790 837 8.98e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222813
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele die by E9 exhibiting morphological and functional alteration of late endocytic compartments, and abnormal triploblastic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,323,521 V1015A probably benign Het
4930480E11Rik C T X: 78,370,262 Q198* probably null Het
Acap3 G C 4: 155,904,931 probably null Het
Adamts14 T C 10: 61,204,910 D879G probably damaging Het
Akap1 A T 11: 88,844,779 C352* probably null Het
Ankk1 T A 9: 49,421,822 T121S probably benign Het
Ankrd6 T C 4: 32,860,438 S2G probably damaging Het
Anks1 G T 17: 27,985,363 probably null Het
Apob G A 12: 8,010,356 G2946D probably damaging Het
Atm A C 9: 53,507,805 C782W probably damaging Het
Atp1a4 A T 1: 172,246,690 I332N probably damaging Het
Bnc2 T C 4: 84,292,915 I406V probably damaging Het
Cdh20 A T 1: 104,947,474 D327V probably damaging Het
Cep192 T A 18: 67,855,270 probably null Het
Chd5 T C 4: 152,372,115 F970L probably damaging Het
Coq9 T C 8: 94,853,124 Y236H probably damaging Het
Csn1s2a A G 5: 87,781,821 H93R unknown Het
Cxcr2 T C 1: 74,158,971 V208A probably benign Het
Cyp1b1 G A 17: 79,713,731 T194M probably benign Het
Dbt T A 3: 116,523,412 V79E probably damaging Het
Dcx A G X: 143,923,432 probably benign Het
Dnm3 G A 1: 162,286,074 probably benign Het
Erbin C T 13: 103,886,197 E45K probably damaging Het
Fastkd1 A G 2: 69,702,616 L469P probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10271 A G 10: 116,972,590 L7S probably damaging Het
Gm5087 T C 14: 13,158,805 noncoding transcript Het
Hid1 A G 11: 115,350,530 S645P probably benign Het
Hmcn1 C T 1: 150,802,873 C499Y probably damaging Het
Ifna1 C A 4: 88,850,213 Q43K probably benign Het
Ikbkb G T 8: 22,669,677 Q432K possibly damaging Het
Inpp4a A T 1: 37,366,594 H148L probably benign Het
Itpr2 C T 6: 146,173,341 R2338Q probably benign Het
Itpr2 A T 6: 146,323,169 I1441N probably damaging Het
Krt78 T C 15: 101,947,106 R757G probably benign Het
Lmx1a T A 1: 167,830,540 probably benign Het
Lpxn T A 19: 12,819,358 S81T probably benign Het
Lrriq1 T C 10: 103,227,250 N65S probably damaging Het
Mis18bp1 T C 12: 65,133,586 D981G probably benign Het
Mpp4 T C 1: 59,144,694 I296V probably benign Het
Mtrf1l T C 10: 5,817,565 R184G probably benign Het
Muc19 T C 15: 91,924,665 noncoding transcript Het
Myo6 T A 9: 80,269,611 probably null Het
Myom1 A G 17: 71,101,220 probably benign Het
Ndrg4 A G 8: 95,678,386 probably null Het
Neu2 A G 1: 87,595,060 S72G probably benign Het
Nlrc4 T A 17: 74,448,045 M59L probably benign Het
Nuak2 A T 1: 132,325,053 H115L probably damaging Het
Olfr243 A T 7: 103,717,542 Y316F probably benign Het
Olfr433 T C 1: 174,042,133 F61S probably damaging Het
Oog1 T A 12: 87,608,408 I272K probably damaging Het
Pcdhb1 A G 18: 37,266,463 Y489C probably damaging Het
Pde5a T C 3: 122,779,002 I344T probably benign Het
Pip5kl1 C A 2: 32,583,347 A332D probably benign Het
Pja1 T C X: 99,467,148 E385G probably benign Het
Psma6 A T 12: 55,408,044 I53L probably benign Het
Ric8b T G 10: 84,947,897 D206E probably benign Het
Sardh T C 2: 27,189,547 D911G probably benign Het
Serpinb8 A G 1: 107,607,046 T32A unknown Het
Shroom2 G T X: 152,660,039 T710K probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc38a7 A G 8: 95,845,796 probably benign Het
Stk36 T A 1: 74,632,825 S895T probably null Het
Sycp3 G A 10: 88,472,682 E205K possibly damaging Het
Tbc1d16 A T 11: 119,157,828 I333N probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmeff1 T A 4: 48,658,831 Y101* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttn T A 2: 76,719,156 T23399S probably damaging Het
Vipas39 A G 12: 87,242,523 V389A possibly damaging Het
Zfp329 A T 7: 12,810,486 H370Q probably damaging Het
Zfp37 C T 4: 62,191,777 G350D probably damaging Het
Other mutations in Vps41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Vps41 APN 13 18866150 missense probably benign 0.37
IGL01563:Vps41 APN 13 18782727 splice site probably benign
IGL01880:Vps41 APN 13 18810471 missense probably benign 0.01
IGL02024:Vps41 APN 13 18791657 splice site probably benign
IGL02458:Vps41 APN 13 18853479 missense possibly damaging 0.67
IGL02740:Vps41 APN 13 18838680 missense probably damaging 1.00
IGL03218:Vps41 APN 13 18829270 missense possibly damaging 0.74
R0197:Vps41 UTSW 13 18854663 critical splice donor site probably null
R0284:Vps41 UTSW 13 18853440 missense probably damaging 1.00
R0321:Vps41 UTSW 13 18842295 splice site probably benign
R0372:Vps41 UTSW 13 18842247 missense probably benign 0.00
R0382:Vps41 UTSW 13 18827727 missense probably benign 0.30
R1691:Vps41 UTSW 13 18841243 missense probably damaging 1.00
R2055:Vps41 UTSW 13 18854616 missense possibly damaging 0.95
R2082:Vps41 UTSW 13 18852351 missense probably benign 0.27
R2147:Vps41 UTSW 13 18839734 splice site probably null
R4322:Vps41 UTSW 13 18823790 missense probably damaging 1.00
R4600:Vps41 UTSW 13 18745283 missense probably damaging 0.97
R4751:Vps41 UTSW 13 18811622 missense probably damaging 0.98
R4856:Vps41 UTSW 13 18829255 missense probably damaging 0.98
R5389:Vps41 UTSW 13 18862538 missense probably damaging 0.99
R7022:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R7456:Vps41 UTSW 13 18864034 missense probably benign 0.02
R7747:Vps41 UTSW 13 18841252 critical splice donor site probably null
R7790:Vps41 UTSW 13 18842268 missense possibly damaging 0.76
R8029:Vps41 UTSW 13 18823785 nonsense probably null
R8033:Vps41 UTSW 13 18810465 missense not run
Z1177:Vps41 UTSW 13 18845935 missense not run
Z1177:Vps41 UTSW 13 18854595 missense not run
Predicted Primers PCR Primer
(F):5'- GTGGCTGAGACTTGTCATATCCTC -3'
(R):5'- ATCTGCTGCCACTGTGCAAG -3'

Sequencing Primer
(F):5'- GAGACTTGTCATATCCTCAGTGC -3'
(R):5'- CTGTGCAAGTGCTAGAGAGAC -3'
Posted On2015-01-23