Incidental Mutation 'R2904:Trim21'
ID261581
Institutional Source Beutler Lab
Gene Symbol Trim21
Ensembl Gene ENSMUSG00000030966
Gene Nametripartite motif-containing 21
SynonymsSsa1, Ro52
MMRRC Submission 040491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2904 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102557921-102565486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102559971 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 282 (W282R)
Ref Sequence ENSEMBL: ENSMUSP00000102526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]
Predicted Effect probably benign
Transcript: ENSMUST00000033264
AA Change: W282R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966
AA Change: W282R

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098227
SMART Domains Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.7e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 225 1.2e-11 PFAM
Pfam:7tm_1 43 294 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106913
AA Change: W282R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966
AA Change: W282R

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210261
Predicted Effect probably benign
Transcript: ENSMUST00000217478
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The encoded protein is part of the RoSSA ribonucleoprotein, which includes a single polypeptide and one of four small RNA molecules. The RoSSA particle localizes to both the cytoplasm and the nucleus. RoSSA interacts with autoantigens in patients with Sjogren syndrome and systemic lupus erythematosus. Alternatively spliced transcript variants for this gene have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Unmanipulated homozygous mice are normal, but leads to tissue inflammation and systemic autoimmunity in vivo and reduced number of CD11c+ dendritic cells from mutant bone marrow in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 T C 5: 100,809,807 E182G probably benign Het
Acot4 C G 12: 84,043,603 T358S probably benign Het
Ap2a2 A G 7: 141,619,478 K433E probably damaging Het
Card11 T A 5: 140,889,133 D592V probably benign Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Crisp1 C T 17: 40,313,004 probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
Fam208b T C 13: 3,582,185 N772S possibly damaging Het
Gak T C 5: 108,624,214 N79S possibly damaging Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Gmpr2 T C 14: 55,672,758 V15A probably damaging Het
Hectd4 T C 5: 121,292,724 probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm4b G A 17: 56,355,884 G152S probably benign Het
Kdm6b G A 11: 69,405,785 T552I possibly damaging Het
Kdr T C 5: 75,966,409 Y307C probably damaging Het
Kif11 T C 19: 37,403,655 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Madd C T 2: 91,175,672 V20M probably damaging Het
Mkrn3 C A 7: 62,418,459 R528L probably benign Het
Myom2 T C 8: 15,098,348 V508A probably benign Het
Nav1 T C 1: 135,585,238 D28G probably benign Het
Nlrp4b T A 7: 10,714,367 W166R probably damaging Het
Olfr113 A T 17: 37,574,814 L203Q possibly damaging Het
Olfr483 T C 7: 108,103,599 Y97H probably benign Het
Rassf10 A T 7: 112,954,549 D119V possibly damaging Het
Smarcc1 A G 9: 110,173,975 N378D possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Uggt2 T A 14: 119,059,109 Y447F possibly damaging Het
Zfp160 G A 17: 21,025,649 V154I probably benign Het
Other mutations in Trim21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Trim21 APN 7 102559598 missense probably damaging 1.00
IGL01729:Trim21 APN 7 102563893 missense probably damaging 0.97
IGL02680:Trim21 APN 7 102559663 missense probably benign 0.44
IGL03349:Trim21 APN 7 102563277 missense probably benign 0.00
R1508:Trim21 UTSW 7 102559576 missense possibly damaging 0.52
R1662:Trim21 UTSW 7 102561898 nonsense probably null
R4482:Trim21 UTSW 7 102563933 nonsense probably null
R5480:Trim21 UTSW 7 102559256 missense probably benign 0.05
R5606:Trim21 UTSW 7 102559606 missense probably damaging 0.99
R6130:Trim21 UTSW 7 102563291 missense possibly damaging 0.95
R6214:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6215:Trim21 UTSW 7 102559439 missense probably damaging 0.96
R6291:Trim21 UTSW 7 102564082 missense probably damaging 1.00
R6731:Trim21 UTSW 7 102559212 missense probably damaging 1.00
R7612:Trim21 UTSW 7 102559535 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTTCCTCTGACATGTGAG -3'
(R):5'- TTTCCTGTGGACATTGAATGC -3'

Sequencing Primer
(F):5'- CTCTGACATGTGAGGAAACTTCATC -3'
(R):5'- ATTATTGAGCCGTCCATGAAGG -3'
Posted On2015-01-23