Incidental Mutation 'R3104:Gfpt1'
ID262955
Institutional Source Beutler Lab
Gene Symbol Gfpt1
Ensembl Gene ENSMUSG00000029992
Gene Nameglutamine fructose-6-phosphate transaminase 1
SynonymsGFA, 2810423A18Rik, GFAT, GFAT1
MMRRC Submission 040578-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3104 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87042846-87092197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87057646 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 142 (D142G)
Ref Sequence ENSEMBL: ENSMUSP00000109288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032057] [ENSMUST00000113655] [ENSMUST00000113657] [ENSMUST00000113658]
Predicted Effect probably benign
Transcript: ENSMUST00000032057
AA Change: D142G

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032057
Gene: ENSMUSG00000029992
AA Change: D142G

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
Pfam:GATase_6 69 213 1e-18 PFAM
Pfam:GATase_4 78 198 2.7e-7 PFAM
Pfam:GATase_7 93 195 2.1e-14 PFAM
Pfam:SIS 378 507 4.5e-38 PFAM
Pfam:SIS 549 680 1.6e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113655
SMART Domains Protein: ENSMUSP00000109285
Gene: ENSMUSG00000029992

DomainStartEndE-ValueType
Pfam:GATase_2 2 65 7.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113657
SMART Domains Protein: ENSMUSP00000109287
Gene: ENSMUSG00000029992

DomainStartEndE-ValueType
Pfam:GATase_2 2 80 1.7e-10 PFAM
Pfam:GATase_2 76 120 9.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113658
AA Change: D142G

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109288
Gene: ENSMUSG00000029992
AA Change: D142G

DomainStartEndE-ValueType
Pfam:GATase_2 2 78 9e-9 PFAM
Pfam:GATase_4 63 191 3.2e-10 PFAM
Pfam:GATase_6 68 211 3.7e-20 PFAM
Pfam:GATase_2 76 220 6.4e-22 PFAM
Pfam:GATase_7 93 194 1.7e-15 PFAM
Pfam:SIS 362 491 4.5e-36 PFAM
Pfam:SIS 533 664 2.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150410
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the first and rate-limiting enzyme of the hexosamine pathway and controls the flux of glucose into the hexosamine pathway. The product of this gene catalyzes the formation of glucosamine 6-phosphate. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ash1l T A 3: 89,054,386 V2355E probably damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bmp4 G A 14: 46,385,981 A36V probably benign Het
Ccdc191 T C 16: 43,931,210 F301S probably damaging Het
Cdh9 T C 15: 16,855,814 S647P probably damaging Het
Cntln C T 4: 84,957,169 T280M possibly damaging Het
Coch A G 12: 51,603,421 T398A probably benign Het
Col6a3 T C 1: 90,816,302 R515G probably damaging Het
Csmd1 A G 8: 17,027,231 Y137H probably damaging Het
Ctnnal1 G A 4: 56,813,246 L662F probably benign Het
Cyp19a1 T C 9: 54,186,799 I60V probably benign Het
Cyp2c68 C T 19: 39,734,313 V264I probably benign Het
Dbx1 A T 7: 49,636,669 L16H probably damaging Het
Dgkg T A 16: 22,575,341 T321S probably damaging Het
Dnah7c T A 1: 46,798,279 Y3951N probably damaging Het
Emc10 G A 7: 44,493,192 R109W probably damaging Het
Fam124b T A 1: 80,213,031 I212F probably damaging Het
Fam187b A G 7: 30,977,240 D58G probably benign Het
Galnt4 T C 10: 99,109,381 Y323H probably benign Het
Gm5174 A G 10: 86,656,655 noncoding transcript Het
Gtf2ird2 G A 5: 134,208,915 D278N probably benign Het
Herc2 T A 7: 56,135,355 D1480E probably benign Het
Hnf4g T G 3: 3,652,856 S388R probably benign Het
Il1rap A G 16: 26,722,752 E581G probably benign Het
Itpr2 A T 6: 146,312,837 probably null Het
Lgr6 A G 1: 135,000,472 probably null Het
Lmod2 A C 6: 24,604,472 K482T probably damaging Het
Magi3 A G 3: 104,051,320 V483A probably damaging Het
Ncam2 A G 16: 81,465,710 probably benign Het
Nphs1 C A 7: 30,467,540 S724* probably null Het
Olfr1094 T C 2: 86,829,691 M313T probably benign Het
Osgep T C 14: 50,916,829 T225A probably benign Het
Pcdhgc5 A G 18: 37,821,674 E667G possibly damaging Het
Plce1 C T 19: 38,620,519 P424L probably benign Het
Plekhg5 C T 4: 152,112,178 T694M probably damaging Het
Prkag2 T A 5: 24,871,069 K233* probably null Het
Prune2 T A 19: 17,119,156 S675T probably damaging Het
Sars C T 3: 108,429,305 R302H probably damaging Het
Sfmbt1 G A 14: 30,817,796 C847Y probably damaging Het
Sparcl1 T C 5: 104,093,337 T74A probably benign Het
Sppl2b A G 10: 80,867,491 E529G probably benign Het
Stradb C A 1: 58,992,291 H212Q possibly damaging Het
Tkfc G T 19: 10,596,993 C198* probably null Het
Tm4sf4 C T 3: 57,437,622 R150C possibly damaging Het
Tmem212 T C 3: 27,884,870 S156G probably damaging Het
Tmem51 T C 4: 142,037,724 N8D probably damaging Het
Tmigd1 A G 11: 76,910,298 T204A possibly damaging Het
Tsga10 G A 1: 37,801,791 L445F probably damaging Het
Unc80 G A 1: 66,623,291 V1768I probably benign Het
Urb1 C T 16: 90,795,443 V310I probably damaging Het
Usp29 T A 7: 6,962,053 C298* probably null Het
Usp8 T C 2: 126,758,512 V1050A probably damaging Het
Vmn1r38 T C 6: 66,776,446 T229A probably benign Het
Yes1 T C 5: 32,653,171 S195P probably damaging Het
Other mutations in Gfpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Gfpt1 APN 6 87056163 missense probably damaging 1.00
IGL00946:Gfpt1 APN 6 87050942 missense probably damaging 1.00
IGL01083:Gfpt1 APN 6 87054696 missense probably damaging 1.00
IGL01930:Gfpt1 APN 6 87059415 missense possibly damaging 0.88
IGL02113:Gfpt1 APN 6 87087367 missense probably benign 0.04
IGL02724:Gfpt1 APN 6 87056182 nonsense probably null
IGL03024:Gfpt1 APN 6 87053831 missense probably damaging 1.00
R0829:Gfpt1 UTSW 6 87053865 splice site probably benign
R1779:Gfpt1 UTSW 6 87077197 missense possibly damaging 0.74
R1982:Gfpt1 UTSW 6 87054630 missense possibly damaging 0.90
R2067:Gfpt1 UTSW 6 87057754 missense probably benign 0.02
R2400:Gfpt1 UTSW 6 87087348 missense probably damaging 1.00
R2438:Gfpt1 UTSW 6 87057745 missense probably null 1.00
R3105:Gfpt1 UTSW 6 87057646 missense probably benign 0.16
R4738:Gfpt1 UTSW 6 87054747 intron probably benign
R5070:Gfpt1 UTSW 6 87053745 splice site probably null
R5292:Gfpt1 UTSW 6 87076255 critical splice acceptor site probably null
R5392:Gfpt1 UTSW 6 87077157 missense probably damaging 0.99
R5481:Gfpt1 UTSW 6 87050969 missense probably damaging 1.00
R5646:Gfpt1 UTSW 6 87042999 start codon destroyed probably null 0.92
R5666:Gfpt1 UTSW 6 87053813 missense possibly damaging 0.94
R6003:Gfpt1 UTSW 6 87088248 unclassified probably null
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6031:Gfpt1 UTSW 6 87086320 missense probably damaging 1.00
R6045:Gfpt1 UTSW 6 87085257 missense probably damaging 1.00
R6341:Gfpt1 UTSW 6 87088145 missense probably damaging 1.00
R6980:Gfpt1 UTSW 6 87077089 missense probably damaging 1.00
R7120:Gfpt1 UTSW 6 87087393 missense probably benign 0.25
R7123:Gfpt1 UTSW 6 87056186 missense probably damaging 1.00
R7249:Gfpt1 UTSW 6 87056144 missense probably damaging 0.98
R7374:Gfpt1 UTSW 6 87050977 missense probably benign 0.00
R7501:Gfpt1 UTSW 6 87082526 missense probably benign
R7502:Gfpt1 UTSW 6 87066689 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCCTAGAAAATATTTGCTGCCTG -3'
(R):5'- GTTATAAATGGAGGTGTGTAGGCA -3'

Sequencing Primer
(F):5'- CCCAGTGGTTTAGAAAACGCATTG -3'
(R):5'- CAAGGTAGGGTCTCTCACTTGAAC -3'
Posted On2015-02-05