Incidental Mutation 'R3115:Cacng7'
ID263973
Institutional Source Beutler Lab
Gene Symbol Cacng7
Ensembl Gene ENSMUSG00000069806
Gene Namecalcium channel, voltage-dependent, gamma subunit 7
Synonyms
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3115 (G1)
Quality Score200
Status Validated
Chromosome7
Chromosomal Location3332955-3368221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3338934 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000090567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092891]
Predicted Effect probably benign
Transcript: ENSMUST00000092891
AA Change: V111A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000090567
Gene: ENSMUSG00000069806
AA Change: V111A

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 196 4.4e-22 PFAM
Pfam:Claudin_2 18 197 2.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203497
Meta Mutation Damage Score 0.0960 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II transmembrane AMPA receptor regulatory protein (TARP). TARPs regulate both trafficking and channel gating of the AMPA receptors. This gene is part of a functionally diverse eight-member protein subfamily of the PMP-22/EMP/MP20 family and is located in a cluster with two family members, a type I TARP and a calcium channel gamma subunit. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and indistinguishable from wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Cacng7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Cacng7 APN 7 3366031 missense probably damaging 1.00
R1006:Cacng7 UTSW 7 3366929 missense possibly damaging 0.87
R4610:Cacng7 UTSW 7 3336691 missense probably benign 0.07
R5357:Cacng7 UTSW 7 3338936 missense probably benign 0.07
R5596:Cacng7 UTSW 7 3366904 missense probably benign 0.21
R5735:Cacng7 UTSW 7 3339023 missense probably benign 0.11
R6222:Cacng7 UTSW 7 3336612 missense probably damaging 1.00
R7187:Cacng7 UTSW 7 3336667 missense probably damaging 1.00
R8086:Cacng7 UTSW 7 3339002 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGGTCAAATCAAGGGTGTGGC -3'
(R):5'- CGCTCAGTGGAAGAAGGTTC -3'

Sequencing Primer
(F):5'- TCCAGTCAGCAGAGGACCTAG -3'
(R):5'- AAGAAGGTTCTTCCCCTAGCTC -3'
Posted On2015-02-05