Incidental Mutation 'R3115:Knl1'
ID263963
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Namekinetochore scaffold 1
Synonyms2310043D08Rik, 5730505K17Rik
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3115 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119047119-119105501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119070391 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 858 (L858M)
Ref Sequence ENSEMBL: ENSMUSP00000097140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
Predicted Effect probably benign
Transcript: ENSMUST00000028799
AA Change: L858M

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: L858M

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000028802
AA Change: L858M

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: L858M

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000099542
AA Change: L858M

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: L858M

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152380
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CACGTGGTCAGGTTGAAATGG -3'
(R):5'- TCTGAGTTTTGCCTGACAGAAG -3'

Sequencing Primer
(F):5'- GCCCAGTGATATAACTCCTGGTG -3'
(R):5'- TGCCTGACAGAAGTTCATTCAG -3'
Posted On2015-02-05