Incidental Mutation 'R3115:Mynn'
ID263964
Institutional Source Beutler Lab
Gene Symbol Mynn
Ensembl Gene ENSMUSG00000037730
Gene Namemyoneurin
SynonymsSBBIZ1, 2810011C24Rik
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R3115 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30602065-30619873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30607810 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 347 (T347M)
Ref Sequence ENSEMBL: ENSMUSP00000141951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably damaging
Transcript: ENSMUST00000047502
AA Change: T347M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730
AA Change: T347M

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192715
AA Change: T347M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730
AA Change: T347M

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194587
Predicted Effect probably benign
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195751
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Meta Mutation Damage Score 0.2424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BTB/POZ and zinc finger domain-containing protein family that are involved in the control of gene expression. Alternative splicing results in multiple transcript variants and a pseudogene has been identified on chromosome 14. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp81 C T 17: 33,334,563 A426T possibly damaging Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Mynn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Mynn APN 3 30613606 missense probably damaging 0.99
IGL01544:Mynn APN 3 30607705 nonsense probably null
IGL02084:Mynn APN 3 30611615 missense probably damaging 1.00
IGL02189:Mynn APN 3 30613544 splice site probably benign
IGL02261:Mynn APN 3 30607131 missense possibly damaging 0.67
IGL02541:Mynn APN 3 30611603 missense probably damaging 0.98
IGL02681:Mynn APN 3 30616642 missense probably benign 0.36
IGL03167:Mynn APN 3 30609042 missense probably damaging 1.00
PIT4494001:Mynn UTSW 3 30607722 nonsense probably null
R0049:Mynn UTSW 3 30607081 makesense probably null
R0321:Mynn UTSW 3 30607557 missense probably benign 0.01
R0420:Mynn UTSW 3 30607459 missense probably benign 0.42
R0574:Mynn UTSW 3 30616739 missense probably benign 0.01
R0576:Mynn UTSW 3 30607068 missense probably damaging 1.00
R1460:Mynn UTSW 3 30603704 missense probably damaging 0.99
R1882:Mynn UTSW 3 30616813 makesense probably null
R3442:Mynn UTSW 3 30613563 missense probably damaging 0.99
R4930:Mynn UTSW 3 30607042 missense probably damaging 1.00
R5153:Mynn UTSW 3 30611589 missense probably benign 0.00
R5351:Mynn UTSW 3 30607542 missense probably benign 0.01
R7446:Mynn UTSW 3 30607052 missense probably benign 0.01
R7468:Mynn UTSW 3 30603676 missense probably damaging 1.00
R7543:Mynn UTSW 3 30607039 nonsense probably null
R8105:Mynn UTSW 3 30611479 missense possibly damaging 0.92
R8423:Mynn UTSW 3 30603784 missense probably benign 0.05
R8512:Mynn UTSW 3 30616649 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGAGCTGGATGCAAGGTTTTC -3'
(R):5'- GGTTAAAAGAATATGGCAGCCTTTG -3'

Sequencing Primer
(F):5'- ATGCAAGGTTTTCCAAGGCC -3'
(R):5'- CAGCCTTTGTTTGTAAGCAATG -3'
Posted On2015-02-05