Incidental Mutation 'R3031:Ubxn7'
ID264737
Institutional Source Beutler Lab
Gene Symbol Ubxn7
Ensembl Gene ENSMUSG00000053774
Gene NameUBX domain protein 7
SynonymsUbxd7
MMRRC Submission 040547-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3031 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32332257-32393747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32375307 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 232 (D232E)
Ref Sequence ENSEMBL: ENSMUSP00000110804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115151] [ENSMUST00000232137]
Predicted Effect probably benign
Transcript: ENSMUST00000115151
AA Change: D232E

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110804
Gene: ENSMUSG00000053774
AA Change: D232E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:UBA_4 15 56 4.3e-15 PFAM
UAS 137 260 3.05e-50 SMART
low complexity region 312 328 N/A INTRINSIC
UBX 405 487 1.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232137
AA Change: D210E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 C A 16: 20,375,113 V753L probably damaging Het
Ap3b1 T C 13: 94,565,643 L1068P unknown Het
Cacna1h C A 17: 25,433,134 R12L probably damaging Het
Cbln4 A G 2: 172,042,180 V40A probably damaging Het
Ccdc170 T C 10: 4,518,931 S160P probably damaging Het
Cdc37 T C 9: 21,143,191 E46G possibly damaging Het
Cltc T C 11: 86,730,332 H287R probably damaging Het
Dsg1a A T 18: 20,340,492 D874V probably damaging Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Hydin A G 8: 110,603,216 R4861G possibly damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lipe T C 7: 25,384,895 E588G possibly damaging Het
Mael T C 1: 166,204,806 D328G probably damaging Het
Mboat7 A G 7: 3,678,688 V398A probably benign Het
Slc35e1 A G 8: 72,484,891 W258R probably benign Het
Slc9a8 A G 2: 167,451,281 D183G probably damaging Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sult3a1 G A 10: 33,877,349 D214N possibly damaging Het
Traf3ip1 T C 1: 91,520,100 V433A probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Vps13c T C 9: 67,923,770 S1561P probably benign Het
Wdr48 T C 9: 119,924,110 V593A probably benign Het
Zfp58 A G 13: 67,492,112 F87L probably benign Het
Zfp663 A T 2: 165,353,696 L201* probably null Het
Other mutations in Ubxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Ubxn7 APN 16 32369398 missense probably damaging 0.97
IGL02149:Ubxn7 APN 16 32375270 missense probably damaging 1.00
IGL02183:Ubxn7 APN 16 32369383 missense probably damaging 1.00
IGL02690:Ubxn7 APN 16 32381605 missense probably benign 0.01
IGL03133:Ubxn7 APN 16 32381781 missense probably damaging 1.00
R0268:Ubxn7 UTSW 16 32360046 missense probably benign 0.05
R0583:Ubxn7 UTSW 16 32375914 missense probably damaging 1.00
R0635:Ubxn7 UTSW 16 32367417 intron probably benign
R0787:Ubxn7 UTSW 16 32381763 splice site probably benign
R1658:Ubxn7 UTSW 16 32381236 splice site probably null
R1916:Ubxn7 UTSW 16 32381759 splice site probably benign
R2070:Ubxn7 UTSW 16 32372469 missense possibly damaging 0.47
R2071:Ubxn7 UTSW 16 32372469 missense possibly damaging 0.47
R3871:Ubxn7 UTSW 16 32381430 missense possibly damaging 0.94
R4994:Ubxn7 UTSW 16 32381504 missense probably damaging 1.00
R5629:Ubxn7 UTSW 16 32332299 missense unknown
R6334:Ubxn7 UTSW 16 32372189 splice site probably null
R6599:Ubxn7 UTSW 16 32384925 missense probably damaging 1.00
R8230:Ubxn7 UTSW 16 32375276 missense probably benign 0.08
R8714:Ubxn7 UTSW 16 32367411 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTGTTTGAAGAATCCATTGC -3'
(R):5'- TCTCTAGAGGAATACGACAAGTACC -3'

Sequencing Primer
(F):5'- TATCACGACAGTGAGGAAG -3'
(R):5'- CCTAAGGAGACCCAATAAAGGTG -3'
Posted On2015-02-05